UCAQ UC AG UGA0 UC UCAG GUC UOPO AC Alanine Tyrosine Stop A GU Valine Y Cysteine G A Stop AG AC A G Tryptophan U Arginine Leucine Serine Lysine A UG Proline Asparagine ACU Glutamic Aspartic acid Glycine Phenyl- alanine Leucine acid Serine Histidine Methionine Isoleucine Giutamine Arginine Threonine

Q: What is the main reason for archiving your phage? so that you could repeat the DNA isolation (for…

A: The answer is to store your phage long term so that anyone who accesses the phage database could…

Q: You are studying a pathogenic bacterium which secretes a toxin that affects G protein receptor…

A: The cAMP signaling pathway, commonly referred to as the adenylyl cyclase pathway, is a cell…

Q: 6. a) What is meant by the term "symbiosis"? [K/U] b) Give an example for each type of symbiosis and…

A: Animals breathe in oxygen and exhale carbon dioxide during the process of respiration. Plants, on…

Q: Essay on Circulatory system

A: Introduction The heart, blood vessels, and blood are all part of the blood circulatory system, which…

Q: (iii) Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop…

A: Hairpin loop structure It is the secondary structure of mRNA where the complementary base pairing…

Q: which protein consists mainly of a helixes  a. hemoglobin     d collagen b cotton               e…

A: The structure of proteins is organized at four levels. The primary structure shows the sequence of…

Q: For your 25ul ligation reaction: You need to add 160ng of your digested insert DNA (which is at a…

A: Given: Total volume - 25ul. The DNA need to be added is 160 ng. One ul contains 160 ng of digested…

Q: 5. What happens to the population density in a declining po a. It decreases. b. It increases. c. It…

A: Population density can be calculated by three different methods they are arithmetic, physiological…

Q: What cell receptor does adrenaline reach

A: Adrenaline or epinephrine is a hormone released by the medulla of the adrenal glands. It is released…

Q: Which of the following things is/are true about this organism? Phylum Chrodata Subphylum Vertebrata…

A: This organism is Lancelet.  Diagrammatic view of lancelet internal structure. Classification of…

Q: 1. In a wild strain of tomato plants, the phenotypic variance for tomato weight is 3.2g². In another…

A: Introduction :- Phenotypic variance is a term that refers to the combination of genotype and…

Q: G. Tactile Location 1. 2. 3.

A: Answer G. Tactile location

Q: Which of the following things is/are true about this organism? invertebrate chordate fish Agnathan…

A: The Arctic lamprey is a little fish that can grow to be over 15 inches long but is usually much…

Q: Starting Molecule(s)   Identify the molecules involved for each step in the process

A: Glycolysis = glucose to pyruvate pathway. TCA = tricarboxylic acid cycle ETC = electron transport…

Q: Which of the following mutations in the Gas subunit of the GPCR pathway for glycogen breakdown in…

A: GPCRs are a large family of cell surface receptors that respond to a variety of external signals.…

Q: Distinguish the following phyla by their characteristics and features. Give a specific example for…

A: Animals are classified on the basis of various fundamental features like level of organization,…

Q: 5) cranial nerve II, the optic nerve sends nerve impulses to the brain carrying information about…

A: It is critical to learn and know the anatomy and physiology of the human body. Many changes in the…

Q: Gibberellins have variety of effects such as ___________, _________ and ___________.

A: Answer

Q: Match the letter to the appropriate bone. Im A d Im

A: Introduction:- The core framework of body is the skeletal system.It is composed of bones as well as…

Q: The normal flow of electrons through the electron transport chain is blocked by sodium azide. Which…

A: The citric acid cycle and electron transport chain is the aerobic stages of cellular respiration.

Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT

A:

Q: Classification of organisms in the three domains is based on: Cell wall. Nutritional type Cell type…

A: Three Domain System:  Carl Woese et al. introduced the three-domain system in 1990, which divides…

Q: Styles raph Lungfishes Amphibians Mammals Tetrapod limbs Lizards and snakes Amnion Crocodiles…

A: A tree like or comb like taxonomic relationship among different group of organisms is called…

Q: Explain why this statement is true, using phylogenetic and morphological evidence. Tunicates…

A: Tunicates are transparent or brilliantly colored marine animals that are found on the dock pilings,…

Q: Draw the mechanism for 5’ capping of mRNA by the associated enzymes (RNA Triphosphatase, RNA…

A: Capping is done in eukaryotic mRNA to prevent the degradation from nucleases. It also assists in…

Q: Explain the signaling steps that take place after the EGF receptor is dimerized, up to the poiunt…

A: As per our company guideline we are supposed to answer only first question or only first 3 subparts…

Q: Explain how viruses differ from living organisms.

A: A virus is an infectious microorganism made up of a nucleic acid segment (DNA or RNA) that is…

Q: Question: Match the following terms with their meanings from the drop down menus. Water potential…

A: Introduction Cell transports are the movement of a substance through the cell membrane. The…

Q: Ecosystems and Biomes. Answer the following below: A.      Describe the climate of  each Biome…

A: Introduction Ecology:- It is a branch of science concerned with the study of the environment and…

Q: Which of the following list places the important evolutionary innovations in the correct order of…

A: ANSWER) (d) Notochord - vertebrae - jaws - bony skeleton - lobe fins - internal nares Notochord -…

Q: primer

A: PCR- it stands for the polymerase chain reaction. it is used to make many copies of a specific…

Q: Describe how Separase, plays a critical role during meiosis and mitosis.

A: Introduction Mitosis and meiosis are the two kinds of cell division. When people say "cell…

Q: You are studying a cell line that expresses both GPCR-A and GPCR-B, each receptor binds the same…

A: The G-protein couples receptor signalling is mediated by a seven pass transmembrane receptor located…

Q: What is the role of lactic acid? It is converted to pyruvic acid through glycolysis. It is a…

A: Introduction Lactic acid is an integral part of the human body, it is is a chemical byproduct of…

Q: Tabla 11.2. External comparison of different leaves. Common name o gender 1 2 3 4 5 6 7 8 9 11…

A: S.No  Botanical Name  Common name Shape of the margin Shape of the foliar lamina Degree of foliar…

Q: Why might the GluR-B mutation prevent calcium from moving through the receptor

A: Glu R- B is the gene that codes for the B subunit of glutamate receptor. When it is formed it is…

Q: You are examining a set of genes from a phage that are transcribed late in infection. You know that…

A: This question is about gene.

Q: Question 2: Consider the following pedigree, which traces the inheritance of a single-gene…

A: Introduction :- A genetic trait or condition can be passed down from parent to child via autosomal…

Q: Which of the following features is NOT helpful in determining the start site of a gene?…

A: Translation: The process through which RNA codes for specific proteins is known as translation. It…

Q: D E- F- Zygomatic Arch Dental Arcade Foramen Magnum Occipital Condyle Occipital Bone [Choose ]…

A: The skeleton of the head is called the skull. It consists of several bones that are joined together…

Q: ic Variation and Evolution Mastery Quiz ay 2 at 2:40pm Instructions Question 1 1 pts In Mendel's…

A: In monohybrid cross of Mendel's experiments : Dominant = TT Heterozygote = Tt  Recessive = tt

Q: Based on the Cytochrome C data, which organism is most closely related to humans? 2. Do any of the…

A: Answer

Q: Briefly explain the generation and conduction of nerve impulse.

A: Introduction The nervous system is one such system that regulates and organises the entire body's…

Q: Explain the figures below in detail, this is about baroreceptors Baroreflex Disturbance Response 1.0…

A: Baroreceptors They are mechanoreceptors found in blood arteries around the heart that detect the…

Q: Two homologous chromosomes in ES cells are depicted below with the portion of your gene of interest…

A: CRISPR/Cas9 creates specific double-stranded breaks at the target locus that trigger DNA repair…

Q: Gibberellins acts in concert with _______________ to promote stem elongation

A: Plant hormones or phytohormons are released from specialised tissue in the plants and responsible…

Q: Ashu did a titer assay with her phage lysate. She started with 100µL of phage lysate (10) and did 7…

A:

Q: Define death in physiological terms.

A: Death is condition which indicated by permanent stoppage of heart, reapiration, and brain…

Q: Gene A encodes for a protein A which prevents exit from the G1 phase of the cell cycle. You are…

A: Cancer is the uncontrolled cell division that is highly under the control of genes. Cell cycle is a…

Q: 2

A: The ovary is part of the female reproductive system. It is an organ that has ova (eggs). These ova…