The energy available to do work in a cell is called: a. thermal energy b. potential energy c. activation energy d. free energy The energy required to destabilize existing chemical bonds is called ____ energy. a. activation b. kinetic c. free d. potential
Q: If you are a strong taster, how many bands would you expect on the gel after electrophroesis? O1 O2 ...
A: Strong taster is the person who gets the taste of food stronger than average people they are called ...
Q: Why is PCR beneficial?
A: INTRODUCTION The Polymerase Chain Reaction (PCR) was formerly originated by American B...
Q: Define the following terms: Predator Prey Population
A: Introduction: Ecology is the branch of biology that deals with ecosystem (interaction between organi...
Q: Considered less stable Whole blood is contained in a Green top tube Whole blood is contained in a Ti...
A: Plasma: Component of blood, pale yellow viscous fluid. Mainly constitute of albumin, globulin, immun...
Q: 1. Cross a male rat with heterozygous brown fur with female rat with white fur. Note that brown is d...
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous c...
Q: Genetic information has become part of our culture and it is difficult to tell the difference betwee...
A: Introduction :- Genetics is a branch of biology that studies genes, genetic diversity, and heredity ...
Q: 1. What is the purpose of the different reagents used in the procedure of kato-katz technique? 2. Ho...
A: the Kato-Katz approach is used for qualitative and quantitative diagnosis of intestinal helminthic i...
Q: Based on the character matrix in the picture, draw a Venn diagram. Start with the character that is ...
A: Venn diagram Venn diagram is a circular or rectangular diagram which illustrates the relationship b...
Q: Write a short essay describing which types of trans-acting proteins bindto which type of cis-regulat...
A: Transcription is the process where RNA is synthesized from DNA. RNA template is then used to synthes...
Q: For each pigment below tell me which colors and ranges of wavelengths it absorbs the most and which ...
A: * photosynthetic pigments also called as accessory pigments and chloroplast pigments and antenna pig...
Q: Label the tissues that form each layer, namely the columnar epithelium, reticular fibers, smooth mus...
A: In this photomicrograph i can't labelled the reticular fibre and loose CTP because of this image not...
Q: Why is a human Rab protein with no direct yeast equivalent chosen as an “outgroup” for a study?
A: Rab proteins →Ras-associated binding proteins are part of the Ras superfamily that are involved in s...
Q: describe why fehling's test is not an accurate for blood-glucose levels?
A: Fehling's solution is a substance reagent used to separate between water-solvent carb and ketone use...
Q: What are the steps in producing a transgenic organism?
A: Transgenic organism Living organisms containing genetic material into which DNA from a different o...
Q: Which of the following results in green output in spectrophotometry experiment? a. Violet light b....
A: Spectrophotometry: it is used for quantitative analysis of spectra of various wavelengths to compare...
Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...
A: Here, human DATP gene sequence of human is given , i.e : ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC
Q: How are chromosomes, DNA, genes, and alleles related?
A:
Q: In Figure 5-11, which donor alleles become part of therecombinant genome produced?
A: Conjugation is the mechanism by which one bacteria directly transmits genetic material to another. ...
Q: What analysis is provided by the study of human age pyramids?
A: Introduction In this question we have to write about the analysis provided by the study of human age...
Q: Describe the hair and give the components
A: Hair Thin elongated keratinized structures present over almost all of the body surface hair is forme...
Q: There are two figures- one for vector control plate & another PCRinsert+vector experimental plate. ...
A: We know that genetic selection of transformed or transfected cells is one of the significant step of...
Q: What are cerebrovascular accidents?
A: The supply of oxygen to the brain is carried out by blood. Blood contains oxygen-carrying molecules ...
Q: Protostomes- which animals are typical and what do these words mean? 1. Acoelomate 2. Pseudocoemate ...
A: The word "protostome" comes from the Greek words "proto," meaning "first," and "stoma," meaning "mou...
Q: in only one cell, label the nucleus, cytoplasm, and cell membrane for these two figures. Describe th...
A: 1. It is simple cuboidal epithelial cell , it is located at lines kidney tubules. Nucleus is presen...
Q: why is it important to learn about infectious diseases in history, and how does that knowledge apply...
A: Infectious diseases caused by organisms like bacteria, viruses, fungus, or parasites. There are nume...
Q: Which of the following is NOT one of the roles of algae in nature? O a. Petroleum is the fossil rema...
A: Introduction : Features of algae : Body is relatively simple unicellular or multicellular thallus ...
Q: What phylum is the closest relative of nemertines? Why?
A: Nemertines: Nemertea, sometimes known as ribbon worms or proboscis worms, is a phylum of organisms....
Q: What phase is the cell in #5 in? O Prophase O Metaphase O Interphase Anaphase
A: *The cell division mitosis will have four stages Prophase Metaphase Anaphase Telophase * During ...
Q: 3 What is Polymerase Chained Reaction (PCR)? How does PCR work?
A: The world as a whole saw a surge of the disease COVID in the year 2020. For the detection of the vir...
Q: Radishes may be long, round, or oval, and they may bered, white, or purple. You cross a long, white ...
A: A dihybrid cross can be utilized to show the inheritance of characteristics to the offspring when pa...
Q: 10. Why is your endocrine necessary to coordinate your body's response to a particular stimulus? Why...
A: Endocrine system It refers to the network of glands and organs. In this system, hormones are involve...
Q: Describe the specimen and explain how the presence of fossil bacteria supports the idea that the Ear...
A: Answer : specimen is the term used for the sample of anything which is used for testing and which te...
Q: Suppose that you are asked to write a new class for DNA. What are the main attributes and functions ...
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and...
Q: what happens to the nuclear material in late telophase?
A: The process that plays an important role in forming new cells from parent cells can be referred to a...
Q: Data Table: Comparison of Mammalian Species (Humans, Mice, Cats, and Baboons) Test 3 Nicotine Recept...
A: Nicotine receptors in Brain. Neuronal nicotinic acetylcholine receptors (nAChRs) are a family of lig...
Q: Explain the features of the Initiator (Inr) elements, BREs, DPEs,and MTEs of focused promoters.
A: The initiator element (Inr), also known as the initiator motif. In a core promoter that functions s...
Q: The following DNA sequence has been identified and named ‘Gene Z’. It is thought that this sequence ...
A: PCR is a polymerase chain reaction, this is a biotechnological process which is used to amplify the ...
Q: What is the role of the cuticle in the successful propagation of nematodes?
A: Nematodes belong to the phylum Nematoda under the Animalia kingdom. These are free living and Parasi...
Q: Find a protein of your choice, choose a part of it (containing at least 30 amino acid residues), fin...
A: Proteins are the working machinery of the cell. They are made up of amino acids that are linked to o...
Q: Please help me in detail. "Molecular Mechanism of ATP versus GTP selectivity of adenylate kinase". D...
A: Enzymes catalyses the chemical reactions and these enzymes are substrate specific .And these enzymes...
Q: Chlamydia trachomatis is a sexually transmitted infection. The organism can be classified in differe...
A: Microbes may enter the body in a variety of ways and cause infection everywhere, but antigen and lym...
Q: 5. Why do you think you feel tired and lethargic when you have a high fever?
A: Humans have evolved to develop body's responses and especially immune responses in such a way that k...
Q: Which of the following is a mismatched? O a. Apicomplexa: Cryptosporidium O b. Ciliate: Giardia Ameb...
A:
Q: Where do spindle fibers attach on a chromosome? O cell plate O meristem centromere
A:
Q: . In an interrupted-conjugation experiment in E. coli, thepro gene enters after the thi gene. A pro+...
A: Part A. The genotypes of the two types of cultures are: pro+ thi- They grow only on the media that...
Q: What is the probability of having red flowers when red snapdragon and white snapdragon are crossed? ...
A: Incomplete dominance refers to the inability to mask the recessive phenotype completely. Hence when ...
Q: comprise the membrane. If you isolated a single transmembrane helix from a protein from this strain,...
A: Since the newly identified bacteria has normal nucleic acids and proteins - the amino acids in the p...
Q: In what ways are Leishmania and Trypanosoma similar with each other?
A: Leishmania is an intra cellular protozoan which is known to cause Leishmaniasis and Trypanosoma cruz...
Q: Which would be most useful in the process of lysing a bacterium so that it's DNA could be collected ...
A: Cell Lysis It is the process of rupturing the membrane or walls of a cell.
Q: Give an example of structural change that has occurred inchromosomes during evolution
A: Evolution : It is the process by which traits of a species change over numerous generations & it...
Question:-
The energy available to do work in a cell is called:
a.
thermal energy
b.
potential energy
c.
activation energy
d.
free energy
The energy required to destabilize existing
a.
activation
b.
kinetic
c.
free
d.
potential
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Question- An enzyme that works best in acidic environment would function best at a pH of ? Options: A. 9 B.11 C.3 D.7Question - is if the cells in our bodies were to convert the required energy into our food substance with only a 20% of the order, how would our bodies function? What consequences would our bodies deal with?Question 2 please It is sometimes lost on even the best student that a plant is capable of performing cellular respiration and photosynthesis. Please LIST the reactants and products of both reactions that are occurring in the test tubes that are in the light. Cellular Respiration Photosynthesis Reactants sugar and oxygen Products CO2 and water Reactants Sun/light CO2 and water Products sugar and oxygen 2. How does the table above (showing reactants and products of 2 important chemical reactions) support the First Law of Thermodynamics (aka – Law of Conservation of Energy)? The law of conservation of energy states that energy cannot be created or destroyed but may be changed from one form to another.
- A. Will decreasing the amount of energy needed to make an exergonic reaction occur cause the reaction to be more exergonic? Why or why not? B. Will such an energetic alteration change the rate of the reaction? Why or why notQUESTION 6 Which of the following statements are true about enzyme inhibitors? QUESTION 6 Which of the following statements are true about enzyme inhibitors? A. Competitive inhibitors cause the slope of the Lineweaver-Burk line to change but not the y-intercept. B. Noncompetitive inhibitors are a type of mixed inhibitors. C. Uncompetitive inhibitors result in an alpha equal to 1 and an alpha' not equal to 1. D. Noncompetitive inhibitors result in lines with increasing [I] to share the same x-intercept. all of the above E. All of the above are true.Explain your answer briefly but concisely 2. What are the steps in the energy-yielding phase?
- Question 1 a. What enzyme works on glucose-6-P when the energy charge is 0.80? b. What enzyme works on glucose-6-P when the energy charge is 0.97? c. What enzyme works on glycogen when the energy charge is 0.80?d. d. What enzyme works on glycogen when the energy charge is 0.97? e. What enzyme works on pyruvate when the energy charge is 0.80 (assume high O2)? f. What enzyme works on pyruvate when the energy charge is 0.97?Relate Gibbs free energy to the direction of a reaction in a cell assisted by enzyme how can a cell control the direction of a reaction Please answer asap and in shortQuestion:- The enzyme aromatase is found in the cytoplasm of some cells and converts testosterone to estrogen. You decide to test aromatase from a particular cell, and oops, your lab partner admits he drastically increased the pH in all the test tubes. Which of the following is a likely result? a. The enzyme will be denatured and the substrate will not bind to the active site. b. The enzyme will convert testosterone to estrogen at a faster rate. c. The mistake will have no effect on the experiment, because enzymes are not sensitive to pH. d. The free energy will be lowered and the reaction will not proceed spontaneously.
- An enzyme A is most active at 37oC. Which of the following change will increase the activity of A? Question 9 options: Increasing the enzyme temperature from 20 oC to 37 oC. Decreasing the enzyme temperature from 37 oC to 25 oC. Increasing the enzyme temperature from 37 oC to 47 oC.Answer TRUE or FALSE.a. According to the lock-and-key model of enzyme action, the active site of an enzyme is not flexible in shape.b. In an enzyme-catalyzed reaction, the compound that does not undergo a chemical change is called the substrate.c. The nonprotein portion of a conjugated enzyme is not the enzyme’s active sited. Simple enzymes are composed only of protein; conjugated enzymes have nonprotein cofactors.Based on the given question which of the following choices is the correct answer?A. When an enzyme catalyzes a reaction, it increases the activation energy of the reactionB. When an enzyme catalyzes a reaction, it decreases the activation energy of the reactionC. When an enzyme catalyzes a reaction, it increases the activation energy of the productD. When an enzyme catalyzes a reaction, it does not affect the activation energy of the reaction.