hi!. so the answer is "Histidine". I need help understanding how they got the asnwer and how to rea the table.Thank you! veredswerUse the mRNA codon table below to answer thequestion.A tRNA with the anticodon 5' AUG 3' would carry theamino acid.....first codon nucleotideUCU Phe SerPheSerLeuSerLeuSerC LeuProLeuProLeuProLeuProsecond codon nucleotideGCysUCys CSTOP AGUCAAllellelleMetG ValValValValtyrosinevalinemethionineargininehistidinenone of theseATyrTyrSTOPSTOPHisHisGinGinAsnAsnLysLysThrThrThrThrAla AspAlaAspAlaGluAlaGluTrpArgArgArgArgSerSerArgArgGlyGlyGlyGlyAGUCACUCAGсAсАthird codon nucleotide

tRNA contains a triplet anticodon which pairs with complementary triplet codon present in mRNA…

Use the mRNA codon table below to answer the question. A tRNA with the anticodon 5' AUG 3' would carry the amino acid..... first codon nucleotide second codon nucleotide G Cys Cys STOP A U C A U Phe Ser Tyr Phe Ser Tyr Leu Ser STOP Leu Ser STOP Pro Pro Pro Pro Thr Asn Thr Asn Thr Lys Thr Lys C Leu Leu Leu Leu His His Gin Gin Alle lle lle Met G Val Ala Asp Val Ala Asp Val Ala Glu Val Ala Glu Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly UUAGUCAGUASCAG ▬▬▬▬▬▬ third codon nucleotide

Use the mRNA codon table below to answer the question. A tRNA with the anticodon 5' AUG 3' would carry the amino acid..... first codon nucleotide second codon nucleotide G Cys Cys STOP A U C A U Phe Ser Tyr Phe Ser Tyr Leu Ser STOP Leu Ser STOP Pro Pro Pro Pro Thr Asn Thr Asn Thr Lys Thr Lys C Leu Leu Leu Leu His His Gin Gin Alle lle lle Met G Val Ala Asp Val Ala Asp Val Ala Glu Val Ala Glu Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly UUAGUCAGUASCAG ▬▬▬▬▬▬ third codon nucleotide

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Provide the DNA sequencce (not RNA sequence) for the Start Codon and 3 Stop Codons.
Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
From the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.
Explain The mRNA codon of valine is: GUC UGG CCA TTG
What's the tRNA strand for the following mRNA strand: AUGGCUAACCUUGUA
codon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is located
look at the code: import random # Define the DNA nucleotidesnucleotides = ["A", "T", "G", "C"] # Define the codon-to-amino acid dictionarycodon_table = { "AUG": "M", # Start codon "UUU": "F", "UUC": "F", "UUA": "L", "UUG": "L", "UCU": "S", "UCC": "S", "UCA": "S", "UCG": "S", "UAU": "Y", "UAC": "Y", "UAA": "*", # Stop codon "UAG": "*", # Stop codon "UGU": "C", "UGC": "C", "UGA": "*", # Stop codon "UGG": "W", "CUU": "L", "CUC": "L", "CUA": "L", "CUG": "L", "CCU": "P", "CCC": "P", "CCA": "P", "CCG": "P", "CAU": "H", "CAC": "H", "CAA": "Q", "CAG": "Q", "CGU": "R", "CGC": "R", "CGA": "R", "CGG": "R", "AUU": "I", "AUC": "I", "AUA": "I", "AUC": "I", "ACU": "T", "ACC": "T", "ACA": "T", "ACG": "T", "AAU": "N", "AAC": "N", "AAA": "K", "AAG": "K", "AGU": "S", "AGC": "S", "AGA": "R", "AGG": "R", "GUU": "V", "GUC": "V", "GUA": "V",…
The 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shownbelow. Identify the Shine–Dalgarno sequence and the initiator codon.5′¬CUACCAGGAGCAAAGCUAAUGGCUUUA¬3′
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
UCAAUGGGGUUUAUAGCG… (there are bases after the last G but we don’t know what they are so there may be some ambiguity for the last codon with regards to the amino acid possibilities) if the translation frame had UCA as the first codon: if the translation frame had CAA as the first codon: if the translation frame had AAT as the first codon: