Vitamins does not contribute any energy at all to our body? True Or false

Q: On the pH scale, where can you find very strong acids and very strong bases? Below 7 O In the middle...

A: pH is used to describe whether an aqueous solution is acidic or alkaline (basic) in nature.  The pH ...

Q: Most of the oxygen in blood is: O Dissolved in plasma Bound to hemoglobin in plasma Dissolved in int...

A: Most oxygen, 98.5 percent, is bound to a protein called hemoglobin and carried to the tissues Most o...

Q: Today, it is easy to make transgenic plants and animals. What are some important  safety and ethical...

A: Recombinant DNA technology  Insertion of desired foreign DNA in an organism. 

Q: STCATCTTGACATTG... 3' same strand now has a single base insertion of an A, indicated in blue. What c...

A: A frameshift mutation is a genetic alteration that occurs when a deletion or addition in a DNA seque...

Q: ee modes of dosage compensation exist in nature. riefly, describe the three different strategies. /h...

A: Males and females of several species have different sex chromosomes and in order to  equalise their ...

Q: Ctenophora Animals Porifera Placozoa Cnidaria Bilateria |Chanoflagellata What is true about the red ...

A: The correct answer is-  d) it includes the most recent ancestor and all of its descendants

Q: Describe cyclic and non cyclic photo phosphorylation.

A: Photosynthesis is a metabolic process in which carbon dioxide react with water , sunlight and Chloro...

Q: Mendel testcrossed grown from green, L yellow, round; 26 gr Are these results co

A: A test cross is an experimental cross of an individual organism of dominant phenotype but unknown ge...

Q: Jane is considering switching to a stricter vegan diet. You would suggest she pay attention to the p...

A: Answer- Option D. Minerals

Q: Describe the role of Vitamin C in collagen synthesis. In your discussion, name the substrate and pro...

A: Vitamin C is essential for collagen synthesis. Vitamin C act as cofactor for the two enzyme required...

Q: What is one statement that would support the theory that all organisms are related? A) The genetic...

A: In addition to being degenerate, the genetic code is also called to as 'unambiguous,' implying so ea...

Q: Fill in the blank with the most appropriate term that is described by the following statement: Close...

A: The components of DNA replication. A five-membered, oxygen-containing ribose sugar ring with three p...

Q: Questions: 1- Name the different type of dialyzers. 2- What is relationship between hollow fiber por...

A: 1... Types of dialyzers cellulose triacetate (CTA), ethylene-vinyl alcohol co-polymer (EVOH), polyes...

Q: How does the increase in the influx of tourists affect the ecosystem of the city?

A: Increase in Tourism/Influx of Tourists negatively implacts  Environmental conditions in that particu...

Q: You are interested in the effect of both soil copper concentration and pH on the growth of plants an...

A: The given setup is considered as one of the simplest growth setup. The growth rate is measured. The ...

Q: List down at least 5 sex-linked traits/disorders located in the p arm and in the q arm. p arm q arm

A: Sex-related disorders are inherited via one of the sex chromosomes, the X or Y. Dominant inheritance...

Q: 7. Draw what you would expect to see for acid fast stain and endospore stain procedure if you did no...

A: Staining is a technique for adding color to cells, tissues, or microscopic components so that they c...

Q: QUESTION 1 In alveoli, oxygen travels: Into capillaries, because of the 02 concentration gradient Ou...

A: Respiration is the process by which all living organisms generate the energy they require to survive...

Q: If you were the professor reading that essay answer, what sort of grade would you assign, and why?

A: When students are asked to write an essay explaining how to distinguish between an animal cell and a...

Q: What factor(s) may have influenced the decrease in the number of deaths from cholera up until the ti...

A: * Terrible outbreak of cholera took place in braod Street of london. *  John snow is anesthesiologis...

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...

A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...

Q: Which of the following best describes an emergent property? Group of answer choices a property that...

A: The organ system is a very complex creature made up of several systems. Each system in the body has ...

Q: For laboratory accreditation, describe and briefly explain the assessment activities during the on‐s...

A: Accreditation of health laboratories is the process by which an independent and authorized agency ac...

Q: What kind of medicine is used to treat ringworm. Is this medicine synthetic or was it isolated from ...

A: Given: Ringworm is caused by the fungus that eats keratin. These are called dermatophytes. They atta...

Q: A DNA

A: DNA acts as the genetic material in most of the organisms . DNA stands for the deoxyribonucleic acid...

Q: Explain how genetic engineering approaches can offer advantages over traditional plant breeding appr...

A: Both genetic engineering and traditional plant breeding aim to generate crops with superior qualitie...

Q: How do protozoa reproduce? Give 1 example for each type.

A: Introduction Single-celled organisms are known as protozoa. They range in size and shape from an amo...

Q: 3. In people suffering from severe malnutrition, OP is often low because a lack of dietary amino aci...

A: Malnutrition is a condition of body in which the body lack nutrients that are important for maintain...

Q: Describe five strategies that can be used to engineer resistance into crop plants. Which strategy do...

A: Introduction The main unit of study in agroecology is the agroecosystem, which is vaguely defined as...

Q: When you add new tRNAs, what happens to the green amino acids they carry at the top of each tRNA?

A: In any cell the DNA ultimately form functional protein and for this every cell form a process called...

Q: You performed an experiment on photosynthesis on Elodea, using bromothymol blue as an indicator for ...

A: Photosynthesis is a necessary process for all plants to live. Plants create sugars (which are stored...

Q: rtant to have a isolated colony? Please use your own words when answering, simple and to the point :...

A: A group of bacteria, fungi, and other microorganisms grown on a solid agar medium represent a colony...

Q: A new enzyme (protein) that helps protect a bacterial cell from reactive oxygen species (causing oxi...

A: INTRODUCTION Bacterial growth curve Represents number of living cells in a bacterial population over...

Q: Tetracyclines are another kind of antibiotics that are made by fungi. They work by inhibiting transl...

A: Most of the microbes release some secondary metabolites;which are not required for their growth and ...

Q: Can you answer all the parts to this question regarding fish (please type the answer)   Mammals hav...

A: Fish gills use a design called ‘countercurrent oxygen exchange’ to maximize the amount of oxygen tha...

Q: How do neurodegenerative diseases such as Alzheimer's and Parkinson's disease relate to the concept ...

A: Introduction :- The progressive loss of structure or function of neurons, known as neurodegeneration...

Q: Biology: Discuss the many properties of water H2O? And also give several examples of the important ...

A: Water is an essential component of life, life is impossible without water as we know that 1st time l...

Q: How is artificial selection different from Darwin's idea of natural selection?

A: The theory of natural selection was explored by 19th-century naturalist Charles Darwin. 

Q: Relative to asconoid organization in sponges the syconoid form exhibits smaller body size increased...

A: Sponges comes under phylum Porifera and they have three different types of body plan. 1)Asconoid spo...

Q: What is the Solubility Properties of Annatto Seeds?

A: Annatto seeds are derived from Bixa orellano tree,native to tropical regions.Annatto seeds are used ...

Q: What is a primate and why do anthropologists consider it important to study them? What features do p...

A: Primates is belong to those groups of animals, thats under included humans, monkeys and animals like...

Q: Using a diagram, outline the processes of the best DNA technology tools/techniques involved in the d...

A: A novel tool for the detection of BCR/ABL fusion gene in chronic myelogenous leukemia (CML) was deve...

Q: Answer the following about Corynebacterium diphtheria... Oxygen requirement: Is it classified as an...

A: Corynebacterium diphtheriae is a pathogenic organism that causes an infectious disease called dipthe...

Q: 1. IDENTIFY THE LINING. 2. IDENTIFY THE ORGAN. 3. IDENTIFY THE SPECIAL STRUCTURE. 1. 2. 3.

A: Introduction:- This organ starts from cricoid cartilage and finishes near the heart, where it splits...

Q: Read the text. Incandescence is the term for light that comes from heat, such as the light of a cand...

A: Introduction: Bioluminescence is the phenomenon of production and emission of light by a living orga...

Q: Peas heterozygous for three independently assorting genes were intercrossed. (a) What proportion of ...

A: The phrases homozygous and heterozygous are used to characterise allele pairings. Homozygous people ...

Q: A 2 NATALIA JAi CLAUDE !al O, A AB AB (A B 5 JANE ii 6 8 MARK |Bi ii MIGUEL DAVID JAJB JAJB |Bi JANE...

A: Introduction: Pedigree analysis is the study of a particular trait that is inherited from one genera...

Q: engineer resistance into crop plants

A: A crop is a plant or plant product that can be grown and harvested for profit or subsistence.

Q: A section of DNA has following sequence of nitrogenous bases: CGATTACAG. Which of the following sequ...

A: Transcription is a process of copying a piece of DNA into RNA. 

Q: Enumerate two conditions that may lead to transformation of cyst to trophozoite stage.

A: Introduction A parasite is an organism that lives on or in another creature and feeds on or at the e...