Q: If a protein is created via the translation of 705 nucleotides, including a start and a stop codon,…
A: The translation is a process in which an mRNA is read and then a polypeptide, made up of different…
Q: Which amino acid(s) have the most codons? Which amino acid(s) have the fewest codons? Can you think…
A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…
Q: What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter…
A: The amino acids are produced by the help of ribosome in the process of translation. In this process…
Q: During the termination of translation, what is the correct polypeptide sequence which will be…
A: DNA is the storehouse of genetic information. This information age expect by the formation of an…
Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…
A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…
Q: The template strand of a double helical segment of DNA consists of the following sequence:…
A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is a…
Q: Which of the following regions on the tRNA are composed of a sequence of nucleotides? a. anticodon…
A: The tRNA is responsible for transferring amino acids at the site of translation or protein…
Q: The codons UGA, UAA, and UAG do not code for amino acids. What is their role as codons in mRNA?
A: Amino acids are the basic structural units or building blocks of proteins. Amino acids are used for…
Q: Which amino acid sequence will be generated during translation from the following small mRNA:…
A: According to the hint given then the start codon is AUG (Met) The stop codon is UGA .
Q: Define the following terms: genetic code, codon, and anticodon. What is the relationship among the…
A: DNA is the storehouse of information in living organisms. It is present inside the nucleus of every…
Q: Taking start and stop codon into consideration, if we have an mRNA sequence with 30 nucleotides, how…
A: Peptides are peptide bonds that connect short chains of amino acids. Dipeptides, tripeptides, and…
Q: According to the adaptor hypothesis, is each of the following statements true or false? A. The…
A: Codons are the triplet nucleotide sequences either of RNA or DNA, which helps in binding specific…
Q: If a protein is created via the translation of 705 nucleotides, including a start and a stop codon,…
A: Central dogma is the process in which RNA is produced from the DNA (transcription) and amino acid…
Q: What is most closely associated with the cell organelle in the process represented in the diagram ?…
A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…
Q: . Which of the following descriptions of EF-Tu is correct? A. EF-Tu delivers fMet- RNA to the A site…
A: Introduction: Elongation factors deliver aminoacyl-tRNA to the ribosome. Ef-Tu is a monomeric…
Q: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…
A: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…
Q: The fourth codon in an mRNA sequence is GGG, which specifies glycine. If we assume that no amino…
A: Translation of messenger ribonucleic acid (mRNA) into amino acid begins at the 5' end and stops at…
Q: How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences…
A: The genetic information flows from the form of DNA into the form of protein and this framework is…
Q: amino acids are covalently linked to tRNAs via what a) phosphodiester bond b) premature…
A: Protein synthesis is governed by the genes which are present on the chromosomes. The genes are first…
Q: The anticodon 3’-CUG-5’ can base pair with which codon in mRNA?
A: Introduction :- A trinucleotide sequence at one end of a transfer RNA (tRNA) molecule that is…
Q: An anticodon has the sequence GCG. What amino acid does this tRNA carry? What would be the effect of…
A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…
Q: An anticodon has the sequence GCG. What amino acid does this tRNA carry? What would be the effect of…
A: Anticodon is a sequence of three nucleotides on a tRNA molecule that bind to a specific…
Q: If a DNA sequence is 5’ CGCTAGACT 3’, the complementary DNA sequence will be? If a DNA sequence is…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: The first amino acid in a purified bacterial protein is methionine. The start codon in the mRNA is…
A: The process of protein(amino acid) formation is called translation and it is the last step of the…
Q: Each tRNA has unique identity elements recognized by its specific enzyme involved in charging it…
A: Transfer RNA (abbreviated tRNA and formerly referred to as sRNA, for soluble RNA is an adaptor…
Q: According to wobble rules, what codons should be recognized by the follow- ing anticodons? What…
A: Wobble pairing was defined as the base-pairing with two nucleotides that do not follow Watson-Crick…
Q: Which of the following are encoded in the terminating codon in protein synthesis? a.…
A: The process of formation of protein molecules is known as protein synthesis. The process of protein…
Q: What is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action…
A: Protein synthesis takes place in the cytoplasm. The mRNA is read in the pair of three bases at a…
Q: Arrange the following steps in correct sequence. Translation 1. Formation of the peptide bond 2.…
A: The nucleotide is the most fundamental component of nucleic acids. The polymers RNA and DNA are made…
Q: When does a peptide bond form during translation? 1) When the P-site and E-site are occupied by TRNA…
A: mRNA is translated to form protein through the process translation with the help of ribosome, tRNA.…
Q: There are 61 mRNA codons that specify an amino acid, but only 45 tRNAs. This is best explained by…
A: Answer: Introduction: The mRNA codons are read while translation, starting with a start codon and…
Q: Three codons on mRNA are not recognised by tRNA what are they? What is the general term used for…
A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in decoding,…
Q: Which of the following is TRUE in translation? A. Amino acyl TRNA containing one amino acid is…
A: The translation is the process by which amino acids chain or polypeptide chain is produced from the…
Q: Which three codons would code for a different amino acid sequence from that coded for by the mRNA…
A: Given: mRNA base sequence: AGU-UCA-CCA Have to determine which three codons will code for a…
Q: A triplet code with three nucleotides per codon is the most efficient way to encode the 20 different…
A: Nucleotides are the building block of nucleic acid whereas amino acids are the building blocks of…
Q: How many amino acids are coded for by the following mRNA: 5…
A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…
Q: What might be the result of a mutation of DNA in which a triplet code such as UAC now says UAA in…
A: Mutation is the change in the DNA which may cause the change in the amino acid of the protein.…
Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…
A:
Q: UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?
A: RNA- It stand for the ribonucleic acid. is a nucleic acid present in all living cells and in some…
Q: How many nucleotides would be carried on a strip of mRNA with 10 codons?
A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…
Q: If methionine is the first amino acid incorporated into a heptapeptide, what is the sequenc of the…
A: Each group of three bases in a mRNA constitutes a codon. Each codon specifies an amino acid.
Q: What molecule/feature ensures that the correct amino acid is added to the peptide chain with reading…
A: The process in which the mRNA is converted into the proteins buy the help of particular codon is…
Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…
A: The central dogma describes the flow of genetic information. It states that genetic information in…
Q: if mRNA has a codon sequence of 5'-UAG-3', it will encode: Ieucine, no amino acide, methionine, a…
A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum create…
Q: The sequence of part of an mRNA is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' What is the sequence…
A: Given mRNA sequence is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' As we know that, Bases in DNA is…
Q: help
A: Translation is the process for synthesizing the protein from mRNA by the action of ribosomes. It…
Q: For each amino acid added to a polypeptide which of the following must happen? a a charged tRNA…
A: Option (d) is correct.
What amino acid is coded for by the mRNA codon 5'-GAG-3'
Question 39 options:
A)
Glycine (Gly)
B)
Proline (Pro)
C)
Glutamate (Glu)
D)
Valine (Val)
E)
None of the above are correct
Step by step
Solved in 2 steps
- UAA is a stop codon. Why does the UAA sequence in the segment of mRNA 5′-G-C-A-U-G-G-A-C-C-C-C-G-U-U-A-U-U-A-A-A-C-A-C-3′not cause protein synthesis to stop?if mRNA has a codon sequence of 5'-UAG-3', it will encode: Ieucine, no amino acide, methionine, a mutation, or an anticodon?When a codon in an mRNA with the sequence 5′-UAA-3′ enters the A site of a ribosome, it is not recognized by a tRNA with a complementary anticodon. Why not? What recognizes it instead?
- The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start codon, what is the third amino acid incorporated into the polypeptide chain?Suppose a gene has the sequence ATGGGTTATCGCGAGTAC. A point mutation changes the gene to read ATGGGTTATGCGGAGTAC. How would the polypeptide product of this gene change?If a strand of mRNA contains the sequence, UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?
- What is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action B. they provide a source of amino acids C. they provide a site from tRNAs to link to mRNAs D. they translate the basic DNA code using tRNA Consider the following DNA bases sequence 3' TAT CGG 5'. what dipeptide is formed if a DNA point mutation converts CGG to CGT? * A. Val-Ala B. Asp-Glu C. Ala- Ala D. Gly-Ala A tRNA molecule possesses the anticodon 5' CGU 3' , which amino acid will this tRNA molecule carry? * A. Threonine B. Valine C. Alanine D. Arginine What will most likely be the effect of the change in the DNA molecule? * A. the change will cause a harmful mutation B. the DNA molecule will be unable to replicate…How many nucleotides would be carried on a strip of mRNA with 10 codons?For each amino acid added to a polypeptide which of the following must happen? a a charged tRNA must bind at the A site of a ribosome b a peptide bond must be made c the mRNA must move down three bases d all of the above
- What is the one-letter amino acid sequence formed from the following mRNA that codes for a pentapeptide that is an endorphin called Leu-enkephalin? 5' AUG - UAC - GGU - GGA - UUU - CUA - UAA 3'Which amino acid sequence will be generated during translation from the following small mRNA: …CCC-AUG-UCU- UCG-UUA-UGA-UUG…? (Hint: Remember where translation starts and stops.) (a) Met-Glu-Arg-Arg-Glu-Leu (b) Met-Ser-Ser-Leu-Leu (c) Pro-Met-Ser-Ser-Leu-Leu (d) Pro-Met-Ser-Ser-Leu (e) Met-Ser-Ser-LeuThe first amino acid in a purified bacterial protein is methionine. The start codon in the mRNA is GUG, which codes for valine. Why isn’t the first amino acid formylmethionine or valine?