The codons UGA, UAA, and UAG do not code for amino acids. What is their role as codons in mRNA?

Q: UAA is a stop codon. Why does the UAA sequence in the segment of mRNA…

A: Stop codons do not specify any amino acid. When ribosome faces any stop codon, it stalls. When the…

Q: How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNA…

A: The process in which eukaryotic ribosome selects its start codon is a part of translation.…

Q: What are the Evidence that most amino acids are specified by more than one codon?

A: Introduction Genetic code is in the form of triplets, with the total of four nucleotides available…

Q: Which of the following segments of RNA are retained after conversion of a pre-mRNA to a mature mRNA?…

A: RNA: it is of different types such as rRNA, tRNA, mRNA etc.

Q: If a tRNA has an anticodon sequence 3′–CCI–5′, what codon(s) can it recognize?

A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles. It includes…

Q: How many of the same proteins are made at the same time by each ribosome in the translation of one…

A: since you have posted 2 questions. we will help you out with the first one only. the cells, a gene…

Q: What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter…

A: The amino acids are produced by the help of ribosome in the process of translation. In this process…

Q: AGGTATCGCAT is a sequence from the coding strand of a gene. What will bw the corresponding sequence…

A: The terms used in the question represents the molecules used during a gene expression. A gene is a…

Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…

A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…

Q: What is a codon and on what kind of nucleic acid is it found?

A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…

Q: What is the basic role of mRNA

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Why can’t the exact sequence of mRNA be determined from a protein’s primary structure? thanks

A: Primary structure of protein  Primary structure of protein is comprise of linear amino acid sequence…

Q: Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of…

A: mRNA  A single stranded RNA which is copied from DNA and contains gene or information about specific…

Q: If the genetic code were overlapping, how many complete codons would the followingsequence encode…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: What are the codons for the variations amino acid?

A: Amino acids are organic compounds that combine to form proteins, which are the building blocks of…

Q: If the nonsense mutation is in the last exon of the mRNA, the result would be:

A: Exons are sections of an RNA transcript, that code for a protein. Exons are separated by non-coding…

Q: what is c-abl mRNA

A: An mRNA is the RNA encoded from a stretch of DNA template strand to serve as a template for the…

Q: TAT is a codon for the amino acid tyrosine (Tyr). If a mutation changes TAT to TAA, what kind of…

A: The genetic code is a set of rules that is used in the living organisms to translate genetic…

Q: The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’…

A:

Q: How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences…

A: The genetic information flows from the form of DNA into the form of protein and this framework is…

Q: The codon is found on mRNA? True or False?

A: Codon is a sequence of three consecutive nucleotides in DNA or RNA, that codes for a specific amino…

Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…

A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…

Q: Given that out of the 64 codons of MRNA, 61 codify amino acids that form polypeptide chains, what…

A: As there are 20 amino acids and 64 possibilities of mRNA codons. There it is expected some amino…

Q: The first amino acid in a purified bacterial protein is methionine. The start codon in the mRNA is…

A: The process of protein(amino acid) formation is called translation and it is the last step of the…

Q: LIOCTOTmats Provide the three-letter amino acid sequence expected from each of the following mRNA…

A: Question - 1- Provide the three-letter amino acid sequence expected from each of the following mRNA…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: The fourth codon in an mRNA is GGG, which specifies glycine. If we assume that no amino acids are…

A: Codon refers to a set of three-nucleotide sequences, which codes for a specific amino acid. The…

Q: The first codon in a mRNA will be ____ and will code for ___ and the final codon will be ______ and…

A: To synthesize protein molecules, a cell must first transfer information from DNA to mRNA through the…

Q: When a codon in an mRNA with the sequence 5′-UAA-3′ enters the A site of a ribosome, it is not…

A: The process of reading the mRNA transcript to form proteins by joining the different amino acids…

Q: The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains…

A: The process of formation of mRNA(messenger ribonucleic acid) molecules on the DNA(deoxyribonucleic…

Q: A sequence of mRNA is mutated such that there is no "start" codon. Which of the following is a…

A: The ribosomal binding on the mRNA requires the presence of Shine Dalgarno or kozak sequence upstream…

Q: If a tRNA anticodon is CAA what is its corresponding mRNA codon? For the genetic code which amino…

A: Genes that provide instructions for proteins are expressed in a two-step process i.e., by…

Q: If a mutation changed the start codon into a stop codon, would this mutation affect the length of…

A: Mutations are the changes in the base sequences of the nucleotides in a gene. They are known as gene…

Q: If the mRNA produced had the sequence ACGCGU, What would be the tRNA anticodon sequence?

A: mRNA is a messenger RNA that is synthesized from the DNA by the process called transcription. The…

Q: What amino acid sequence is coded for by the mRNA base sequenceCUC-AUU-CCA-UGC-GAC-GUA?

A: The sequence of a protein is notated as a string of letters, according to the order of the amino…

Q: If the template strand of DNA carries the code: GGT-AAT-ACT, then what is the corresponding mRNA…

A: The central dogma of life involves three major steps that include: DNA replication: This is the…

Q: When translation begins, the first amino acid heads to the small subunit of the ribosome.  What…

A: The translation is a process in molecular biology whereby the cell reads information from messenger…

Q: Codon to be read in the mRNA is 5' GAA 3', what is the amino acid?  a. E b. K c.F d.L

A: Dear student answer of your question is given below:  Given codon in the mRNA is 5' GAA 3' ,  It…

Q: The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the…

A: Answer- According to the genetic code, all the 20 amino acids are coded by 64 set codons of…

Q: Some mutations that do not alter the identity of the encoded amino acid lead to diminished…

A: A mutation is an alteration in the nucleotide sequence of the genome of an organism, virus, or…

Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…

A: The central dogma describes the flow of genetic information. It states that genetic information in…

Q: Why does a bacterial mRNA bind specifically to the small ribosomal subunit?

A: The ribosome is a very complex structure, whose machinery is broadly divided into larger and smaller…

Q: When a triplet of bases in the coding sequence of DNA is “GCA,” the corresponding codon for the mRNA…

A: there are two types purines and pyramidines. A=T G=C In case  of mRNA  A=U Thymine is replaced by…

Q: if mRNA has a codon sequence of 5'-UAG-3', it will encode: Ieucine, no amino acide, methionine, a…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum create…

Q: How does the synthesis of a polypeptide chain come to an end when a stop codon is encountered?

A: The translation is the process, in which the polypeptide is formed from the incorporation of the…

Q: What codon is present near the 3′ 3end of all mRNA molecules?

A: Messenger RNA ( mRNA), this name was proposed by Jacob and Monod. It is always single stranded…

Q: A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon…

A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…

Q: How and why do prokaryotic mRNA and eukaryotic mRNA differ?

A: mRNA or messenger RNA is a nucleotide molecule that carries information from the DNA to form…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.