The sequence of part of an mRNA is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' What is the sequence of the DNA coding strand? Of the DNA template strand?

Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…

A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…

Q: AGGTATCGCAT is a sequence from the coding strand of a gene. What will bw the corresponding sequence…

A: The terms used in the question represents the molecules used during a gene expression. A gene is a…

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: If the DNA sequence is ATG-CGT, the mRNA codons are ___.   ATG-CGT   UAC-GCA   GUA-CGU   AUG-CGU…

A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…

Q: List the sequences of the mRNA molecules transcribed from thefollowing template DNA sequences:a. T G…

A: The sequence of DNA that consists of genetic information is transcribed into RNA. The sequence…

Q: 70. Which of the following codes for the stop codon in mRNA? A.UUC B.UGA C.AUG D.AAA

A: Answer  B) UGA

Q: A certain mRNA strand has the following nucleotide sequence: 5'—AUG—ACG—UAU—AAC—UUU—3' What is the…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: The mRNA sequence AUG CAC AGU codes for the first three amino acids of a particular protein. Which…

A: The mRNA synthesized after transcription process undergoes translation to synthesize proteins. The…

Q: If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed…

A: Transcription is the first of several steps in gene expression in which a particular segment of DNA…

Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…

A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…

Q: A ribosome binds to the following mRNA at the site indicatedby the dark box. At which codon will…

A: The mRNA strands obtained after the transcription of the antisense DNA strand (also known as the…

Q: Considering each nucleotide sequence in an mRNA molecule: [1] write the sequence of the DNA template…

A: Gene expression is the process by which the instruction in the DNA is converted to products through…

Q: For each DNA segment: [1] What is the sequence of the mRNA molecule synthesized from each DNA…

A: Gene expression is the process by which the instructions in the DNA is converted into a functional…

Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…

A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…

Q: A gene contains the sequence GGCTAAC. What is the sequence of the MRNA transcribed from this strand…

A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: If a DNA sequence is 5’ CGCTAGACT 3’, the complementary DNA sequence will be? If a DNA sequence is…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: 5’GCTATAAAGCGTATCGCGTCATA 3

A: Complementary mRNA      5’GCT ATA AAG CGT ATC GCG TCA TA '3     3'CGA UAU UUC GCA UAG CGC AGU AU '5

Q: DNA strand with the sequence 3’ AACGTAACG 5’ is transcribed. What is the sequence of the mRNA

A: Messenger RNA (mRNA) is a single-stranded RNA molecule that is complementary to one of the DNA…

Q: DNA Leading strand: 5' AAA ATA | CGC TTT|TTA ATT| AAC CCC GGG 3' A | B| C I D Exons: A, C, D…

A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: b) the sequence of the…

A: The given DNA sequence is as follows 3’–CGATACGGCTATGCCGGCATT–5' The above given strand is a…

Q: In transcription, the nucleotide sequence CAATGGC in DNA would code for [1] in mRNA. O GTTACCG O…

A: The genes are the segments of DNA which carries information for the synthesis of the functional…

Q: A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that…

A: Noncoding DNA sequences are DNA sequences that do not encode protein sequences in an organism.…

Q: If the sequence of the coding strand in a transcription unit is writtenas follows:5'…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: 3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T…

A: Since we are entitled to answer first question, we’ll answer the question 3 as you have not…

Q: What would be the mRNA strand if the DNA strand reads: T A C C G A G T C A C G?

A: The process of transcription starts as the DNA of a gene serves as a template for complementary…

Q: In the DNA segment 5'-ATGAGGCATGAGACG-3' (coding strand) 3'-TACTCCGTACTCTGC-5' (template strand)…

A: A DNA segment is generally a genomic feature recognized by anonymous DNA probes. Symbols for such…

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: Introduction According to Chargaff's rules, DNA from any cell of any organism should have a 1:1…

Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’    Label the sense and antisense strands…

A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…

Q: Which three codons would code for a different amino acid sequence from that coded for by the mRNA…

A: Given: mRNA base sequence: AGU-UCA-CCA Have to determine which three codons will code for a…

Q: What will be the sequence of the single-stranded RNA transcribed from the following segment of…

A: Answer: TRANSCRIPTION : It is the process in central dogma in which single stranded RNA is formed…

Q: Codon to be read in the mRNA is 5' GAA 3', what is the amino acid?  a. E b. K c.F d.L

A: Dear student answer of your question is given below:  Given codon in the mRNA is 5' GAA 3' ,  It…

Q: If the DNA has a triplet code of CAG in one strand (the strand used as a template for transcription)…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: If a DNA sequence , 3' TAC AAT GAA 5' , is the template for transcription, the resulting mRNA would…

A: CENTRAL DOGMA:- The whole process of Central Dogma involves two processes:- 1) When DNA changes into…

Q: Transcribe the DNA strand into MRNA. Don't forget the spe rules for RNA! ranslate the MRNA into an…

A: Transcription is the process of producing RNA called mRNA from a DNA molecule, which codes for the…

Q: A certain template DNA strand has the following nucleotide sequence:…

A: Nucleotides can be described as the nucleic acids’ building blocks. The two forms of nucleic acid…

Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…

A: The central dogma describes the flow of genetic information. It states that genetic information in…

Q: A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this…

A: During transcription, DNA information is transcribed into messenger RNA, which is then used to…

Q: What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC…

A: The information from the DNA is transferred to RNA by transcription. The information present in the…

Q: If the sequence of a coding strand of a gene is 5' ATGGCAT 3', the sequence of the MRNA would be:…

A: DNA stores genetic information. The nucleotide sequence of DNA has the information which codes for…

Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…

A: 1. DNA- GTATACCAGTCATTTGTC mRNA- CAU AUG GUC AGU AAA CAG Amino acids - His- Met-Val-Ser-Lys-Gln

Q: The template strand (i.e.: the strand that is transcribed into RNA, which is usually represented “at…

A: Introduction: DNA is the genetic material that transfers from one to another except for some viruses…

Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…

A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…

Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon…

A: ANSWER;- 3'UCA 5' Explain;- Transcription is a process of a particular DNA sequence being copied…

Q: If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the…

A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: This type of mutation, where one nucleotide was replaced for another, is called a point mutation.…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.