what are the different hoods in the lab and why are they important?

Q: o What is a pure culture? o Describe the procedure for making a streak plate from a clinical specime...

A: Introduction A growth media, also known as a culture medium, is a solid, liquid, or semi-solid mediu...

Q: 5'.GTCATCTTGACATTG... 3' The same strand now has a single base insertion of an A, indicated in blue....

A: A mutation is a change in our DNA sequence that happens as a result of errors in DNA copying or envi...

Q: Discuss the diseases associated with deficiencies or toxicities of the major minerals

A: An increased need for the mineral, lack of the mineral in the diet, or difficulty absorbing the mine...

Q: Which of the following hierarchy of life levels are not correct? Group of answer choices 1. Molecul...

A: Life has evolved from simpler cells to complex multicellular organisms. This is also evident as the ...

Q: Question 10. What are the means for the number of nucleotides that changed along the left and the ri...

A: In the new prediction, we observe that the left and right lineages have almost the same mean number ...

Q: Identify the fibrous materials seen on the field.

A: Introduction Tissue which is composed of bundles of collagenous white fibres between which rows of ...

Q: Neodermatahas two classes: class Trematoda and class Monogenea. Class Trematoda has the subclass Dig...

A: Monogenea is flat worm, this is simple life cycle, this is ectoparasite, so less hamful.

Q: How are animal cell tight junctions and desmosomes (aka adhesion junctions) different?

A: Tight junctions form a water tight seal and prevent material from passing between cells. Desmosomes ...

Q: How did the authors arrange that Mfn2 was only upregulated in the brain and spinal cord of TMFN mice...

A:

Q: A section of DNA has following sequence of nitrogenous bases: CGATTACAG. Which of the following sequ...

A: Transcription is a process of copying a piece of DNA into RNA. 

Q: Describe the role of Vitamin C in collagen synthesis. In your discussion, name the substrate and pro...

A: Vitamin C is essential for collagen synthesis. Vitamin C act as cofactor for the two enzyme required...

Q: Let's work on Z and D values. In the graph below, what are the z-values for each of the curves shown...

A: Linear (XY) graph has points that show the relationship between two sets of data. A XY Line graph us...

Q: Cat ovary region? structure? layer? region? * Region: cortex or medulla

A: Above region is Cortex..   Lower region is medulla  

Q: Interpret the given cladogram:

A: An evolutionary tree that diagrams the ancestral relationships among organisms is known as the clado...

Q: .GTCTCTTGACATTG... 3' the nucleotide highlighted in yellow is mutated to a C, what consequence will ...

A: A missense mutation occurs when a single base pair is changed, causing a different amino acid to be ...

Q: 4. What are some ways on how your body regulates the increase in temperature, heart rate, and respir...

A: Homeostasis -- Different physiological strategies are maintain the proper functioning of a system in...

Q: g best describes the complete sequence of steps occurring during every cycle of PCR? I-The primers h...

A: A laboratory method used to make many copies of a specific piece of DNA from a sample that contains ...

Q: After a long excursion in the tropics you came back  with multiple soil samples from different local...

A: ISOLATION OF ANTIBIOTIC PRODUCING FUNGI FROM DIFFERENT SOIL SAMPLE:  1.COLLECTION OF SAMLPLE:  soil ...

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...

A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...

Q: the chemostat.

A: Chemostats in research are used for investigations in cell biology, which is a source for large volu...

Q: It all about flowering plants-use for asexual and sexual reproduction example Please help it is due ...

A: Sexual maturity is the age in which the reproductive organs mature and mating occurs. In context of ...

Q: Describe its shape. What does the shape of the age pyramid tell you about their population?

A: It is the ageing population. It is urn shaped age pyramid.

Q: 3. If membrane potentials are clamped at the given voltages, indicate which direction the lodine wil...

A: Ans. 3) Clamped cell voltage is the experimental method in which the cell membrane potential is held...

Q: From information in the chapter about the AB0 blood types, what phenotypes and ratios are expected f...

A: The term phenotype refers to an organism's observable physical properties, which include the organis...

Q: According to Atterberg, between the ________________ and ______________ limits, a soil is in a plast...

A:

Q: II. Answer the following: 1. What does NADPH do? 2. In the Krebs cycle, isocitrate releases a molecu...

A: Citric acid cycle is also known as Krebs cycle or tricarboxylic acid cycle. It is the main source of...

Q: Fill in the blank with the most appropriate term that is described by the following statement: Synth...

A: Transcription  Cellular process in which RNA is synthesized using DNA as a template known as transcr...

Q: Tetracyclines are another kind of antibiotics that are made by fungi. They work by inhibiting transl...

A: Most of the microbes release some secondary metabolites;which are not required for their growth and ...

Q: Name and discribe the two main cells in living things

A: Introduction :- The smallest unit in biology that can live on its own and makes up all living creatu...

Q: а. Explain how each of the following variations could help in the survival of an organism: 1.) Speed...

A: Natural selection It refers to the process through which living organisms that are better adapted to...

Q: A region of the genome is amplified by PCR to analyze two closely linked SNPs. PCR products from ind...

A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA (deoxyr...

Q: If you crossed a heterozygous fruit fly with straight wings and red eyes to one with curly wings/whi...

A: A phenotypic ratio helps to determine the likelihood of a trait and is most easily determined by uti...

Q: 1. an organism changing during its life to be better suited for its environment

A:     Answer - An organism changing during its life to be better suited for its environment.

Q: The force causing air to flow into the lungs during ventilation is: Decreased lung pressure Increase...

A: Air flows inside and outside the lungs die to the pressure difference in atmosphere and inside lungs...

Q: How do neurodegenerative diseases such as Alzheimer's and Parkinson's disease relate to the concept ...

A: Introduction :- The progressive loss of structure or function of neurons, known as neurodegeneration...

Q: A wealthy elderly couple die together in an accident. Soon a man shows up to claim their fortune, sa...

A: Since you have asked multiple questions , we will solve the first question for you. If you want any ...

Q: E. coli cells have peritrichous flagella. What does this mean?

A: Escherichia Coli, also referred as E.coli, is the rod-shaped, gram negative bacterium. It generally ...

Q: Give a) 3 examples of biotic components b) 7 examples of abiotic components

A: Biotic refers to the living components of an ecosystem and abiotic refers to the non-living componen...

Q: Using a diagram, outline the processes of the best DNA technology tools/techniques involved in the d...

A: A novel tool for the detection of BCR/ABL fusion gene in chronic myelogenous leukemia (CML) was deve...

Q: 1. IDENTIFY THE LINING. 2. IDENTIFY THE ORGAN. 3. IDENTIFY THE SPECIAL STRUCTURE.

A: This diagram is of the mucus layer, which we can clearly identify as we can see in the image 3 layer...

Q: Week 4 BIO 202 worksheet Blood vessels 1. What is the name of the outermost layer of a blood vessel?...

A: Note :- Since you have asked multiple questions im only answering the ist 5 as per bartleby guidelin...

Q: Energy is stored long-term in the bonds of used short-term to perform work from a(n) molecule. and a...

A: Adenosine triphosphate (ATP) is the energy currency of all living cells. Cells need ATP molecules to...

Q: List atleast 50 laboratory equipments or tools. Just list, no need to give the uses

A: ANSWER;-  50 laboratory is;-  

Q: During ________, maternal and paternal chromosomes that occur in a gamete are shuffled. Group of ans...

A: Ans) This shuffling process is known as recombination or "crossing over" and occurs while the chromo...

Q: What is the Malthusian Theory? Is the Malthusian Theory applicable today or not at all? Please expla...

A: Introduction A population is a group of individuals of the same species who live in the same region ...

Q: What process begins endosperm formation? How is the endosperm important to plants?

A: Formation of endosperm and its importance to plants: The endosperm is formed during the double ferti...

Q: 1. Consider a locus having two alleles Aj and A2, If the homozygote A¡A¡ and the heterozygote A¡A2 h...

A: Frequency of an allele refers to how frequently a particular allele appears in a population.

Q: In mice, the allele C for colored fur is dominant over the allele c for white fur, and the allele V ...

A: A) Parents Genotype should be (CC,Vv) and (cc,VV).Mating has occured between a normal colored mice w...

Q: Micronutrients play a critical role in assisting metabolic enzyme functions in our body? A. True B. ...

A: Enzymes are biocatalysts that are used to increase the rate of reaction and enzymes are not used up ...

Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...

A: Introduction A cell's ability to receive, process, and transmit messages with its surroundings and w...