.GTCTCTTGACATTG... 3' the nucleotide highlighted in yellow is mutated to a C, what consequence will this have on the protein? ) missense mutation, likely affect on protein ) silent mutation, no affect on protein nonsense mutation, likely affect on protein

.GTCTCTTGACATTG... 3' the nucleotide highlighted in yellow is mutated to a C, what consequence will this have on the protein? ) missense mutation, likely affect on protein ) silent mutation, no affect on protein nonsense mutation, likely affect on protein

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 13P: Chemical Mutagenesis of DNA Bases Show the nucleotide sequence changes that might arise in a dsDNA...

See similar textbooks

Related questions

Q: Match each of the follwoing

A: In 1961, Matthaei became the first to describe the structure of a codon. tRNA is a literal "adaptor"...

Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...

A: A... Communication between two plant cell.. cell to cell communication. Through the plasmodesmata. B...

Q: Explain the importance of natural pigments in fruits and vegetables

A: Answer : The importance of pigmentation in fruits is that the pigmentation plays an important role i...

Q: Jane is considering switching to a stricter vegan diet. You would suggest she pay attention to the p...

A: Answer- Option D. Minerals

Q: Which of the following gives the correct pathway for food as it moves through the digestive system? ...

A: The process of converting complex food substances to simple absorbable forms is called digestion and...

Q: Cite the 3 major types of biomes

A: Introduction A biome is a huge naturally occurring community of plant and fauna that can be found an...

Q: What do their resources tell you about the types of people that do science?

Q: Describe active transport across the plasma membrane marking note of concentration gradient Nd energ...

A: Cellular transport is a very important phenomena that occurs inside the cell because there are a lot...

Q: In which ways does the limb orientation of "advanced" tetrapods differ from that of "primitive" tet...

A: Tetrapods are the four limbed structure.And these limbs have derived from fins.The limbs of all tetr...

Q: QUESTION 1 Atherosclerosis is caused by: O Lipids being transported in the blood Hypertension leadin...

A: High blood pressure or hypertension is a condition where pressure exerted b blood against the wall o...

Q: How does hypersecretion of growth hormone (GH) affects the body?

A: INTRODUCTION Hypersecretion of growth hormone can leads to gigantism or acromegaly.

Q: Fill in the blank with the most appropriate term that is described by the following statement: Trans...

A: Introduction Ribonucleic acid, or RNA, is a long, single-stranded protein-processing chain found in ...

Q: What process begins endosperm formation? How is the endosperm important to plants?

A: Formation of endosperm and its importance to plants: The endosperm is formed during the double ferti...

Q: This case study is used to help illustrate the respiratory content you have been studying. It will a...

A: #Chronic bronchitis- This the long term inflammation of bronchi. This is common caused in chain smok...

Q: Biology: Discuss the many properties of water H2O? And also give several examples of the important ...

A: Water is an essential component of life, life is impossible without water as we know that 1st time l...

Q: An individual who swam in freshwater during the summer after a time experiences intense head pain, n...

Q: The following items are ions: O Na+, NO2, H+ O CO2, K+, Ca+ Na+, H+, K+ СО2, Н20, NO2

A: The human body contains many ions such as sodium, potassium, calcium, chloride ions. They are calle...

Q: C. Solve these problems by listing the given genotypes, test crosses, genotypic and phenotypic ratio...

A: Serrated leaf is a dominant feature in plants that is represented by the genotype(Aa Aa) whereas smo...

Q: How is RNA interference (RNAI) used as a form of gene therapy? O Small pieces of RNAI are used to si...

A: There are few points about RNA interference: It is an evolutionary conserved mechanism of gene regu...

Q: Specify the correct number of chromosomes and chromatids in each of the following human cell types. ...

A: Introduction: When a cell prepares for division, It makes a new copy of the DNA. The one half of th...

Q: D. melanogaster

A: melanogaster, has been heavily used in research in genetics and is a common model organism in develo...

Q: Woody Guthrie, who wrote This Land is Your Land, was heterozygous for Huntington’s disease (Hh). His...

A: Given Woody Guthrie - heterozygous for Huntington’s disease (Hh) His wife - homozygous recessive ...

Q: Imagine that a couple is planning to have children. The male is heterozygous for Huntington’s diseas...

A: Introduction Heterozygous means that you have inherited various versions of a gene from each parent....

Q: During the third step of PCR, Taq polymerase adds nucleotides to the growing DNA segments. Why is Ta...

A: Polymerase chain reaction i.e PCR is a molecular technique which is used to make multiple of the fra...

Q: Which of the following events best explains the annual saw tooth pattern that is seen in the Keeling...

A: Introduction The Keeling Curve is a graph depicting the accumulation of carbon dioxide in the Earth'...

Q: What is the Malthusian Theory? Is the Malthusian Theory applicable today or not at all? Please expla...

A: Introduction A population is a group of individuals of the same species who live in the same region ...

Q: This is a hw question Define protein denaturation and explain its significance to metabolism( chemic...

A: Introduction:- Proteins are big, complex molecules that play a number of important tasks in the huma...

Q: What is the best specimen for a urine collection? ** specimen underlined in original practice exerci...

A: Urine is collected for many works like urine test, pregnancy test; for checking urine infection (UTI...

Q: How does the increase in the influx of tourists affect the ecosystem of the city?

A: Increase in Tourism/Influx of Tourists negatively implacts Environmental conditions in that particu...

Q: Complete the energy pyramid by writing the source of the energy for the food web and how much energy...

A: Introduction An organism's trophic level is the position it holds in a food chain. A food chain is a...

Q: Both Porifera and Placozoa possess epithelial tissues. True False

A: ''Since you have asked multiple question, we will solve the first question for you. If you want any ...

Q: 1. IDENTIFY THE EPITHELIUM. 2. WHAT STRUCTURE IS LINED? 3. IDENTIFY THE ORGAN.

A: 1.

Q: Drag and drop the appropriate labels onto the cross section of the Cut Bank below the Highlevel/LRT ...

A: 6)River deposits. 5) vegetated berm 1)top soil(with brick)

Q: Cat ovary region? structure? layer? region? * Region: cortex or medulla

A: Above region is Cortex.. Lower region is medulla

Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...

A: Introduction The cell is life's most fundamental structural and functional unit. Cells are the build...

Q: What kind of medicine is used to treat ringworm. Is this medicine synthetic or was it isolated from ...

A: Given: Ringworm is caused by the fungus that eats keratin. These are called dermatophytes. They atta...

Q: Sharon is a 21-year old 200-meter runner, who now trains twice daily for 2-3 hours each session. Cur...

A: 1) Sharon is an athelete, thus she need to maintain a low body fat and higher muscle mass percentage...

Q: Fixing free nitrogen from the air means converting into ions that can be used by many types of organ...

A: Nitrogen cycle It is biogeochemical cycle of nitrogen where nitrogen converted into many chemical f...

Q: J. ach compound on the left with its name on the right. Match the name with the functional E. group ...

A: Functional groups are atoms that bind to an organic molecule's carbon backbone and give certain prop...

Q: Describe its shape. What does the shape of the age pyramid tell you about their population?

A: It is the ageing population. It is urn shaped age pyramid.

Q: 2. In plants known as "four-o-clock", the allele for the dominant red-flower is incompletely dominan...

A: Introduction: Incomplete dominance is a form of inheritance in which one allele for a specific trai...

Q: 3. In people suffering from severe malnutrition, OP is often low because a lack of dietary amino aci...

A: Malnutrition is a condition of body in which the body lack nutrients that are important for maintain...

Q: Briefly describe the disease and provide the most common symptoms/features of Chronic Myelogenous Le...

A: Definition:- Chronic myelogenous leukemia (CML) is an uncommon type of cancer of the bone marrow — t...

Q: Achondroplasia is the most common form of dwarfism in miniature horses. Achondroplasia dwarf horses ...

A: It is option C.The horse is Heterozygous because it was able produce a non dwarf offspring.

Q: In rats, black fur color is dominant to white fur color, and pointy ears are dominant to round ears....

A: Introduction The relationship between two gene variants is referred to as dominant. Each parent give...

Q: What are 5 facts about fermentation?

A: Introduction: Pyruvic acid is a 3 carbon compound formed as the end product of glycolysis. Glycolys...

Q: Write the sequence of the a. Gas pathway b. Gai pathway Name at least 3 second messeng

A: Gas pathway: Flux through the glyoxylate shunt, as well as anaplerotic processes for pyruvate oxidat...

Q: 3. Someone in your office has the flu. How would the social habits of your office cause other people...

A: INTRODUCTION Answer of question number 3 is given below.

Q: The following pedigree follows the inheritance of myopia (nearsightedness) in humans. Predict whethe...

A: The pedigree is the symbolic representation of the inheritance pattern of a particular disease in th...

Q: The activated sludge process was developed from empirical knowledge and is now widely used for wast...

A: Activated sludge-The activated sludge process is a type of wastewater treatment process for treating...

Concept explainers

Hematology

Hematology is the branch of biology. Hematology is the medical field that deals with the treatment of blood disorders and cancers, such as hemophilia, leukemia, lymphoma, and sickle-cell anemia. Hematologists and hematopathologists are medical professionals who specialize in illnesses of the blood and its components.

Question

Please help a bit confused

Template strand:
5'..GTCTCTTGACATT... 3'
if the nucleotide highlighted in yellow is mutated to a C, what consequence will this have on the protein?
missense mutation, likely affect on protein
silent mutation, no affect on protein
nonsense mutation, likely affect on protein

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?
RNA polymerase from E. coli (core enzyme alone) has all of the following properties except: a)requires all four ribonucleoside triphosphates and a DNA template. b)can extend an RNA chain and initiate a new chain. c)recognizes specific start signals in DNA. d)produces an RNA polymer that begins with a 5'-triphosphate. e)is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.
Base on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary template strand of DNA that pairs with the coding strand?
Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence and direction of mRNA synthesized from this DNA?
Silent Mutations in DNA – Notice one nucleotide pair differs from the normal sequence given in question #6. 5’ ATG GGA GAT TAT TAG 3’ (non-template strand) 3’ TAC CCT CTA ATA ATC 5’ (template strand) What would be the mRNA sequence when this mutated DNA is transcribed? What would be the resulting amino acid sequence when your answer to 7a is translated?
Mutated DNA Sequence #1 T A C A T C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this?
a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain:b. the leftDNA:mRNA:polypeptide chain: