Q: Which of the following enzymes relaxes the DNA double helix to avoid tensional force from supercoili...
A: DNA ligase:- DNA ligase works by catalyzing the formation of a phosphodiester bond between nucleotid...
Q: Explain : Vpr counteracts LAPTM5 to promote HIV-1 infection in macrophages
A: Vpr means viral protein R and it is a HIV gene and protein product. This gene is responsible for vi...
Q: In individuals affected by cystic fibrosis, salt crystals may appear after perspiration dries up. In...
A: Cystic fibrosis It is an autosomal recessive disorder that affects mucus-producing cells. This disor...
Q: Using a Venn diagram differentiate muscular strength from muscular endurance.
A: Muscular Strength:- The amount of force that a muscle can produce in one single contraction. Muscula...
Q: A metabolic pathway_____ . a. may build or break down molecules b. generates heat c. can include red...
A: A metabolic pathway is a set of chemical events seen in biological processes that aid in the convers...
Q: What will be the role of dentist in preventing antibacterial resistance?
A: INTRODUCTION Infections are not mainly respond to the antibiotics are called as antibiotic ...
Q: .32 10 p^2 68 q^2 .46 2pq .1 Number of Mottled 90 Individuals Number of Orange .44 Individuals
A: The Hardy–Weinberg principle, also known as the Hardy–Weinberg equilibrium, model, theorem, or law i...
Q: Which of the following statements is NOT TRUE under the Costly Signaling Theory? Group of answer cho...
A: Costly signalling theory is often interchangeably used with the 'Handicap principle'. CST defines th...
Q: Why is it best to examine a freshly collected stool sample in clinical parasitology laboratory? ...
A: INTRODUCTION In the Medical Parasitology, the specimen collection is an important part th...
Q: ch below with axygen level and function for each heart section. Function: Only identify where the bl...
A: Heart: it is an organ that pump the blood across the body via vascular system. Vascular system: it ...
Q: describe and demonstrate the digestive, breathing, and circulation processes and integrate it with t...
A: Energy required to do all the activities of the body is derived from food . Digestive system allows ...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: Sea urchin development. Basic features of the formation of the axes: A-P & L-R and the role of micro...
A: EMT/Ingression - Epithelial mesenchymal transition is a crucial process for placing the mesoderm ben...
Q: An epitope associates with which part of an antigen receptor?
A:
Q: Please choose all that apply for Phylum Echinodermata. water vascular system endoskeleton O eutely O...
A: An echinoderm is any member of the phylum Echinodermata, organisms belonging to the phylum Echinoder...
Q: Lactate is usually removed from the muscle cells by a(n) that also transports O antiporter, H* O ant...
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
Q: For context: This activity will examine the classification of invertebrates and the methods used to ...
A: Invertebrates: the animals lacking backbones and usually devoid of internal skeleton system, comes u...
Q: Why do we need to be aware of cultural differences and be culturally appropriate?
A: The integrated and maintained system of socially acquired values, beliefs, and standards of conduct ...
Q: What traits or innovations allowed movement of animals onto land, and why might these traits have be...
A: Physical or behavioural adaptations are possible. A physical adaptation is a form of structural adju...
Q: 1. Discuss how the transcending functions are associated with the integrative levels of organization...
A: Ecosystems are arranged to help researchers better understand the context in which they are being ex...
Q: Which type of molecule recognizes macromolecules that are present in/on certain groups of pathogens?...
A: Introduction: Phagocytosis is a process in which the phagocytic cells engulf the microbes. It is an ...
Q: What makes the stomach unique? A. Its ability to perform mechanical digestion B. Its tolerance of a ...
A: Let's see which statements are wrong to identify the correct answer:- Option A is Incorrect because ...
Q: Which of the following comprise a DNA helix structure? A. Carbohydrate backbone B. Nitrogenous...
A: 1. DNA helix is a double stranded DNA helix structure . Helix structure means the both strand of DNA...
Q: When light hits the center of an ON-center receptive field, which of the following processes occur: ...
A: The following facts are required to be known to answer this question with logic:- Suppose there is ...
Q: Identify one component of the cell. Describe the structural appearance using your own words Explain ...
A: 1)Cell is the smallest basic structural, functional and biological unit of life.The main components ...
Q: Explain the relationship between turgor and osmotic pressure
A: Turgor pressure allows the osmotic entry of water through a semipermeable membrane into a cell. This...
Q: When the relative abundance of an organism is used to determine the overall health of an environment...
A: Bioindicators are organisms, such as lichens, birds, and bacteria, that are used to monitor the heal...
Q: 6. In Drosophila melanogaster, the wild-type eye colour is dark red. A pure-breeding mutant strain w...
A: Introduction :- The term "purebred" refers to offspring that are the consequence of a real breeding....
Q: Explain the importance of the protein structures (from its primary to quaternary structures) in thei...
A: Proteins are important biological molecules which are involved in normal functioning of biological s...
Q: Hypothesize as to why iron can have an impact on bacterial growth, particularly S. Typhimurium, S.e...
A: INTRODUCTION Iron is an essential element for bacterial growth. Because it's participation in tricar...
Q: Which molecules recognize the TATA box before RNA polymerase binds to the promoter region? Mitotic ...
A: The transcription is the process by which RNA is produced from the DNA. In case of prokaryotic cells...
Q: The mechanisms of evolution that we have learned contribut organisms we have today. We can see these...
A: Endangered species are any species that is at risk of extinction because of sudden rapid decrease in...
Q: investigate anabolic steroids and their use in sports. b. Determine how they affect skeletal muscle...
A: Steroids are the artificially made hormones, as a version of natural hormones.
Q: The same team of researchers sets up an additional cross with this same population. They cross two f...
A: Dominant allele always express themselves in heterozygous condition.
Q: What the grandparents' genotypes are? Why doesn’t the father (II-1) have the disease breast cancer?...
A: Genetic inheritance is the process by which genetic information is passed from the parents to the pr...
Q: Is Thomas Hunt Morgan an interdisciplinary thinker?
A: Thomas Hunt Morgan Native -American Specialization -zoologist geneticist Famous experiment -dorsophi...
Q: A drug designed to inhibit the response of cells to testosterone would alme A. a decrease in recepto...
A:
Q: Describe Brownian motion. What causes it? How does one differentiate between Brownian motion, water ...
A: Brownian motion or movement is that the uncontrolled movement of particles or zigzag pattern of move...
Q: Please answer fast Briefly describe the pathways the body can use to make each of the Big Four clas...
A: The 4 classes of macromolecules are - carbohydrate Lipid Protein Nucleic acid Carbohydrate pr...
Q: Enumerate clinically relevant parasites that can be visualized using the Kato-Katz method in a clini...
A: The most prevalent method of gastrointestinal infection is the contamination of water, food, and han...
Q: The cornsnake (Pantherophis guttatus) has a recessive allele for pigmentation that causes albinism (...
A: Reptiles are the class of Animals that are cold blooded. They inhabit both, the land and the waters....
Q: The common garden pea (Pisum sp.) can have green or yellow pea pods. Green peas are either homozygou...
A: Introduction Heterozygous means that you have inherited different versions of a gene from each paren...
Q: Comprehensive explanation about how the species of finches , that were found by darwin at galapagos ...
A: Natural selection, according to Charles Darwin's theory of evolution, is how evolution occurs. Physi...
Q: QUESTION 4 Which of the following is NOTa part of an inflammatory response? O Edema Histamine releas...
A: Inflammation: it is a natural immune response of the body against harmful agents. Inflammatory respo...
Q: Flg. 1. Breast cancer families 1 to 7. Solid circles, females with breast cancer; open circles, fe- ...
A: Solution:- We are given the following probabilities:P(woman will develop breast cancer gene) = 1/10P...
Q: micrograph
A: The ovary is an organ found in the female reproductive system that produces an ovum . Fertilization...
Q: Discuss the role of the regulator in relation with DNA damage and recombination in the article histo...
A: A histone is a protein that gives chromosomes structural support. Very long DNA molecules wrap aroun...
Q: explain the scope of practice for EMTs in arizona. Is the scope of practice dictated by the state ...
A: Scope of Emergency medical technician is good in Arizona. Avg salary per hour for emt in arizone is...
Q: Identify and explain what insects are expected to have the most sclerotized heads? Does an exoskelet...
A: Scelerotin is typically a brown coloured substance found in cuticles of insects. Scelerotin is forme...
Q: Write a brief discussion about "The path of ethical conduct: Learn to do good
A: Ethics define the set of rules provided by an external source. For example principles in religion or...
what are the different taxonomic classifications of protozoans
Step by step
Solved in 3 steps
