what are the function(s) of the major organelles in the animal and plant eukaryotic cell?

Q: Structures in order as it relates to the pathway of blood flow through the heart/body after is leave...

A: The oxygenated blood from the lungs are sent to the heart via Pulmonary Vein which drains the whole ...

Q: phylogenetic tree

A: A phylogenetic tree is a branching diagram or a tree showing the evolutionary relationships among va...

Q: REPLICATION TRANSCRIPTION TRANSLATION The specific location in the cell where the process happens Su...

A: The Central Dogma of life involves three steps: DNA ==> DNA ==> RNA ==> Proteins The proces...

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...

A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...

Q: In a cross between mice the genotypes AB/ab x ab/ab, what is the recombination frequency if the prog...

A: The recombination frequency is used to calculate the distance between the genes. If the genes are pr...

Q: The aquiferous system of a leucon sponge and the gastrovascular cavity of large anemones are both a ...

A: The primary distinction between Cnidaria and sponges is that cnidarians have tissue grade bodies whi...

Q: Please match the tissue to the description. covers the ends of bones in a joint [ Choose ] [ Choose ...

A: Cartilage. This is a type of tissue that covers the surface of a bone at a joint. Cartilage helps re...

Q: Bacillus cereus and Bacillus thuringiensis are very closely related species and cannot be distinguis...

A:

Q: How does fluoride toxicity results in plant necrosis?

A: Plants can become poisoned as a result of the buildup of harmful inorganic minerals such as fluorine...

Q: D. melanogaster

A: melanogaster, has been heavily used in research in genetics and is a common model organism in develo...

Q: What are the lineages of the tree of life that we divide into prokaryotes vs. eukaryotes

A: Prokaryotes are unicellular organisms that lack membrane-bound structures including nucleus. Prokary...

Q: In general, the greatest vulnerability to teratogens occurs during: Group of answer choices the last...

A: Teratology It is the study of abnormal development in embryos and the causes of congenital malformat...

Q: What happens if you breed a patchwork fish with a blue scaled fish? 1. P1: _________ x _________ 2...

A: Codominance  is a condition ;in which the phenotypic effects of  each allele is observed in the hete...

Q: Define isoenzymes

A: Enzymes are biocatalyst that helps increase the rate of chemical reactions and in the process, they ...

Q: Why do infants experience emotions?

A: Emotion is defined as a complex experience of consciousness, bodily sensation, and behaviour that re...

Q: 2. In plants known as "four-o-clock", the allele for the dominant red-flower is incompletely dominan...

A: Introduction:  Incomplete dominance is a form of inheritance in which one allele for a specific trai...

Q: It is a fact that insects are widely distributed in any type of ecosystem. Some are vectors of causa...

A: Unlike the closed circulatory system found in vertebrates, insects have an open system lacking arter...

Q: Explain structure, reproduction and life cycle of polyporus in detail.

A: Polyporus : classification   Kingdom        :          Fungi Division          :         Basidiomyco...

Q: What are two examples of macro-molecules formed by dehydration synthesis ?

A: A macromolecule, such as a protein, is an extremely big molecule. They are made up of thousands of a...

Q: Nematocyst toxins which paralyze prey are called

A: Introduction :-  Nematocysts, are a common feature of all cnidarians. They are enormous organelles t...

Q: II. Answer the following: 1. What does NADPH do? 2. In the Krebs cycle, isocitrate releases a molecu...

A: Citric acid cycle is also known as Krebs cycle or tricarboxylic acid cycle. It is the main source of...

Q: This case study is used to help illustrate the respiratory content you have been studying. It will a...

A: #Chronic bronchitis- This the long term inflammation of bronchi. This is common caused in chain smok...

Q: 1. Identify the organ.

A: This organ starts from cricoid cartilage and finishes near the heart, where it splits into two parts...

Q: Find a fish of the body types listed below. Not all fishes can be described by one of these terms. P...

A: Answer : Adaptation is an important survival skill in all species. Adaptations are changes an organi...

Q: What is a primate and why do anthropologists consider it important to study them? What features do p...

A: Primates is belong to those groups of animals, thats under included humans, monkeys and animals like...

Q: DISEASE CAUSATIVE ORGANISM VECTOR

A: Causative organism or agent  in infection are pathogens. vector is a quantity or phenomenon that has...

Q: Šize-dependent migration distances of DNA fragments in an agarose gel Length of DNA fragments (bp) D...

A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to answ...

Q: Why is there a need for an incubator in the lab? How about incubating cultures at room temperature? ...

A: The Incubator is an insulated device in which the conditions like temperature, humidity, pH, and man...

Q: Peas heterozygous for three independently assorting genes were intercrossed. (a) What proportion of ...

A: The phrases homozygous and heterozygous are used to characterise allele pairings. Homozygous people ...

Q: When someone reads a scientific paper to learn about a new drug, that person should NOT: a. Determin...

A: Drug  Drug is any material that is use to treat a disease or lower down the effect of a disease or a...

Q: How do protozoa reproduce? Give 1 example for each type.

A: Introduction Single-celled organisms are known as protozoa. They range in size and shape from an amo...

Q: Neodermatahas two classes: class Trematoda and class Monogenea. Class Trematoda has the subclass Dig...

A: Monogenea is flat worm, this is simple life cycle, this is ectoparasite, so less hamful.

Q: What is the major function of the Parathyroid glands?

A: Introduction;  Parathyroid glands are actually 4 pea sized endocrine gland located on the posterior ...

Q: o What is a pure culture? o Describe the procedure for making a streak plate from a clinical specime...

A: Introduction A growth media, also known as a culture medium, is a solid, liquid, or semi-solid mediu...

Q: 1. IDENTIFY THE BASIC TYPE OF EPITHELIUM. 2. GIVE THE SPECIFIC NAME OF THE EPITHELIUM. 3. IDENTIFY T...

A: A stratified squamous epithelium is a flattened epithelial tissue that are arranged in layers over a...

Q: Which group is the least related to humans? Name two organisms that don't form a clade together. Exp...

A: The phylogenetic tree is called an evolutionary tree. The tree represents the evolutionary relations...

Q: Both ocelli and statocysts are composed in part of nerve tissue. True False

A: Answer : Both ocelli and statocysts are composed in part of nerve tissue.  false.  

Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...

A: Introduction The cell is life's most fundamental structural and functional unit. Cells are the build...

Q: Identify the fibrous materials seen on the field.

A: Introduction Tissue which is composed of bundles of collagenous white fibres between which rows of ...

Q: This is compact bone, please use ARROWS to identify the following: osteon lamella lacuna canaliculi...

A:

Q: Use your textbook or a reliable online resource to help you define the following 4 terms in your lab...

A: The substrate is any substance that reacts to the active site of an enzyme. A chemical bond is forme...

Q: health benefits and trvias of table tennis

A: Answer 

Q: Briefly describe the disease and provide the most common symptoms/features of Chronic Myelogenous Le...

A: Definition:- Chronic myelogenous leukemia (CML) is an uncommon type of cancer of the bone marrow — t...

Q: Which plant showed growth ? Why

A: Introduction  Plant Hormones are also known as Phytohormones. Phytohormones are the signaling molecu...

Q: Cat ovary region? structure? layer? region? * Region: cortex or medulla

A: Above region is Cortex..   Lower region is medulla  

Q: In secondary growth, grows inward towards the middle of the stem, and grows outwards towards the edg...

A:   The majority of plants have the capacity to grow throughout their life, which is in contrast to an...

Q: A. Observation of growth characteristics on selective and differential media Mannitol salt Agar Bact...

A: S.aureus stands for staphylococcus aureus. If we are to grow this bacteria in Mannitol salt agar med...

Q: A teácher aškš students to create a model thát will help predict the most likely blood type of an in...

A: Scientific models are created to assist people in understanding scientific concepts and to convey th...

Q: oes a person who is overweight or obese have more fat cells as compared to a person that is of norma...

A:

Q: How does ivf work ?

A: IVF is an abbreviation for in vitro fertilization. It is one of the most well-known forms of assiste...

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.