Q: Clostridium botulinum is a strict anaerobe; that is, it is killed by the molecular oxygen (O2)…
A: INTRODUCTION Clostridium botulinum This is a gram positive, anaerobic spore forming bacteria that…
Q: Which of the following is NOT a component of the 30S initiation complex? A. EF-Tu and EF-Ts B.…
A: Translation Translation involves the transfer of information in mrna molecules into the aminoacidsl…
Q: How does the mouth achieve initial digestion of polysaccharides? due to the enzymatic action…
A: Please follow step 2 for detailed explanation.
Q: What is the functional cell of the nervous system?
A: The nervous system in association with the endocrine system , serves as the primary control centre…
Q: Alzheimer’s.
A:
Q: prokaryotic and eukaryotic cells: Characteristics Ribosomes Chromosome Cell Division Sexual…
A: Prokaryotes are the primitive type of cell. Prokaryotes don't have a well defined nucleus whereas…
Q: Why are nonnative species often considered a disturbance in an ecosystem? They increase mutations.…
A: Introduction :- Non-native species are organisms that do not naturally occur in a given area but are…
Q: Which are the techniques that may be used for viable counting methods of microbial measurements?…
A: Micrometers, or one millionth of a metre, are used to measure the size of microbes. Microbes can be…
Q: A student is observing a pond which includes the following: • 2 frogs • 5 ducks • Several species of…
A: Ecosystem are made up of both biotic and abiotic factors. Abiotic system are non livings things…
Q: 8. In cats, S = short hair, s = long hair, XC = black coat, XC = yellow coat, and XCXC calico coat.…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: biocatalyst pre-treatment required for biohydrogen production? If yes, then explain any two…
A: Biohydrogen production The biological production of hydrogen is referred to as biohydrogen. Since…
Q: respiration are two processes involved in the O Carbon cycle Nitrogen and water cycle Carbon and…
A: Biological mechanisms that move matter and energy through the ecosystem include cellular respiration…
Q: Which among the following is generally considered weakest among Bradford Hill’s guidelines: a.…
A: The following is generally considered weakest among Bradford Hill's guidelines: c. specificity
Q: How is maternal inheritance different from the segregation Mendel observed for nuclear genes
A: The maternal inheritance is different from the segregation that Mendel observed for nuclear genes.…
Q: In which reagent is extracted DNA suspended to put it in solution? O Sodium dodecyl sulfate (SDS) O…
A: Introduction DNA extraction is a method to isolate DNA in a biological sample, which is done by…
Q: Determine the effect (increase, decrease, no effect or cannot be determined) of the stated condition…
A: DNA is Deoxy ribonucleic acid’s and DNA have sugar phosphate as backbone and this sugar phosphate…
Q: Bacterial DNA will be recognized by innate immune cells though binding to: O TLR8 O TLR9 TLR2 TLR4
A: Innate Immunity: Immunity that is innate, or nonspecific, is a protective system that you were born…
Q: hytochrome, plays an important role in flowering in many plants. It can also be used to determine…
A: Phytochrome Phytochrome is a type of photoreceptor which is present in the plants, bacteria, and…
Q: Examine the life process that requires sunlight. sunlight Which gas, represented by the letter Y, is…
A: Introduction:- Photosynthesis is the physico-chemical process by which plants convert light energy…
Q: Explain MTE, how Kleiber’s and Boltzmann’s theories are fundamental to MTE,
A: * The metabolic theory of ecology is extension of Metabolic Scaling Theory and Kleiber's law. *…
Q: Draw the chemical structure of the 5' end of nascent RNA transcript in eukaryote:
A: Chemical structure of the 5' end of the nascent mRNA be like-
Q: Label the grasshopper testis under microscope
A:
Q: Please answer fast and all 1. Outline how external environmental factors can affect the stability…
A: Lichen is a symbiotic relationship between algae and fungi. Algae prepares its food for itself and…
Q: Label the rat testis under microscope.
A: Testis are the main male reproductive part. Spermatogenesis occurs here to form the male gametes.
Q: 2. A skunk's odor is unpleasa coloration warns birds of its animals to A) find water B) find prey C)…
A: Introduction: The creation of offspring is referred to as reproduction. There are two types of…
Q: DNA is a large molecule and is wrapped around proteins called: O a. Histones O b. Ligase O c.…
A: DNA (deoxyribonucleic acid) is the molecule that conveys genetic information for an organism's…
Q: sigma factor: promoter as O protein: DNA O mRNA: tRNA -35 element: GATCC element O elongation:…
A: Transcription is the process of making an mRNA copy of a gene (DNA). It is catalyzed by an enzyme…
Q: The organism Euprymna scolopes is most likely related to- B. Tasmanica euprymna. A. Nipponensis…
A: Introduction Euprymna is a bobtail squid genus that includes several species.
Q: Gametogenesis Label the rat testis slide.
A: 1 is sertoli cells 2 is basement membrane 3 is Interstitial cells 4 is secondary spermatocytes
Q: Provide information in the following table showing the principal differences between prokaryotic and…
A: Eukaryotic cells have well defined nucleus. Whereas prokaryotic cells have nucleoid in place of…
Q: Which reagent removes contaminant proteins from DNA solution? Sodium dodecyl sulfate (SDS) O Sodium…
A: A major goal of the nucleic acid isolation is the removal of proteins . The seperation of nucleic…
Q: A life-form from another universe is found to have nucleic acid which includes six different bases -…
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: Briefly describe endocrine disruptors, how they act, toxicity caused and the effects they bring…
A: Hormones are chemical substances produced by our body's endocrine system, which releases the…
Q: enzyme is necessary for the "degredation of peptone
A: Peptone is a decomposition product of protein formed by either partial or complete degradation of…
Q: Q4/ What is Osteoporosis disease? Explain the pharmacist role in giving the suitable prescriptions…
A: Across most vertebrate animals, a bone is a hard organ that is part of the skeleton. Bones protect…
Q: A pregnant staff is concerned about harmful radiation to her fetus. She can work on these areas of…
A: Non-ionizing radiological procedures These are the imaging procedures which does not use ionising…
Q: A rare genetic disorder affecting the degradation of hemoglobin made a man suffer extreme…
A: Sangers method is a DNA sequencing method and is also known as enzymatic chain termination method.…
Q: 9.Statement 1: Major histocompatibility complex proteins help the immune system recognize 'self' vs…
A: Immunity deals with the study of how body's immune system works against foreign pathogens to…
Q: Create a level of organization of all the parts of the tilapia fish.
A: Introduction - Tilapia is a fish that is solely found in Africa, and many states in the United…
Q: What is the possible cause of the presence of an extra band in the results of DNA extraction and PCR…
A: This finding suggests that formation of multiple bands in non-denaturing gel electrophoresis is a…
Q: Aspartate and phenyalanine become apartate and isoleucine
A:
Q: sigma factor: TFIID TBP as O Pribnow box: TATA box O RNA polymerase holoenzyme: RNA polymerase II…
A: Sigma factor is a protein essential for the initiation of transcription in bacteria.It enables…
Q: Did widespread treatment with antimalarial drugs (ACTs) reduce the prevalence of malaria in the…
A: Introduction Malaria is a serious human disease that is caused by sporozoan parasites (genus…
Q: How much of the world's supply of recombinant insulin is produced by S. cerevisiae? a. 90% b. 50% O…
A: Introduction Insulin is a hormone that aids the entry of blood sugar into cells so that it can be…
Q: Why do plants carry out anaerobic respiration? They produce 02 which is toxic to their system. Their…
A: *Anaerobic respiration will occurs in cytoplasm of plants and hence they will experience anaerobic…
Q: In some viruses, capsomeres function as enzymes as well as structural supports. Of what advantage is…
A: Viral capsids are nanometre-sized containers that possess complex mechanical properties and main…
Q: The planula stage in Cnidarians is similar to what life stage in two other non-animal organisms?…
A: It is critical to learn and know the anatomy and physiology of the body. Many changes in the animal…
Q: Using the formulae for dsDNA to calculate g/mol: You have a 4110 bp cloning vector Want to ligate a…
A: The average weight of a single DNA bp is 650 daltons. This can also be represented as 650 g/mol (=…
Q: How does primary and tertiary structure influence the function of uniprotkb-p39086?
A: There are few important points : Proteins are unbranched polymers constructed from 22 standard alpha…
Q: Based on the figure below, what is the number of turnovers in stage B? D 34 24 16 4 Geological…
A: Species turnover is defined as the number of species in a specific geological age which pass over to…
Step by step
Solved in 2 steps
- Question:- a.Explain the production of chymosin in a prokaryotic vector and the problems encountered in its production. b. What is chymosin used for and why the need for cloning the gene?Question:- Viral vectors are not the only method being studied for gene therapy purposes. Which of the following is a nonviral delivery method for gene therapy? a.gene pills b.DNA bound to the surface of liposomes c.electrically stimulating cells to take up DNA d.DNA covered with proteinQuestion:- Is DNA sequencing a in vivo, in vitro and/or in silico? What product(s) is/are formed in DNA sequencing and how and where would the reaction begin? Also, what raw materials are needed?
- Question:- All the necessary ingredients for the Polymerase Chain Reaction (PCR) are mixed together in a PCR tube and placed in the thermal cycler. The DNA polymerase is from Thermus aquaticus,the template is human DNA, and the primer is complementary to the gene for a human protein. What would result from amplification? Group of answer choices a.a mixture of human DNA, RNA, and protein b.human DNA c.human protein d.T. aquaticus DNA e.a mixture of human and T. aquaticus DNAQuestion:- What is genetic engineering? What organisms can it be performed on? Please give an example of at least one successful genetic engineering project. Where was CRISPR/Cas9 initially found? What was its purpose in that organism?Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question When or why is this genetic technology/process used? Who benefits from this genetic technology/process - and how?
- Question: Gene therapy: a) what disease is it used for? b) what genetic defect causes the disease? c) what and how viral vector is used AND/OR CRISPR-Cas is used? d) what is in the horizen re. development of new virus-based gene delivery vesicle?QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.What factors could explain a transformation efficiency?
- Question- There are 2x10-3 mutations in every replication of a given strain of bacteria, and this bacterium replicates once every 30 minutes. How many mutations are there in 5 hours, assuming carrying capacity of the environment is very large (i.e. the bacteria are still in exponential growth) and there is one bacterium at t=0? The answer is ________.Question:- If you have 7 large DNA duplexes, how many TOTAL DNA duplexes will you have after 7 rounds of PCR (include large-medium, medium-short, and short-short)? If you have 7 large DNA duplexes, how many short-short DNA duplexes will you have after 7 rounds of PCR (do NOT include large-medium and medium-short)?Question 1 a) What are the key modifications to the PCR primers, SHFw1 and SHRv1 in order for you to clone the PCR amplified Sonic Hedgehog into the multiple cloning site (MCS) of pSELECT-CGFP-blasti. Explain your answer in detail b) After you have successfully cloned Sonic Hedgehog into pSELECT-CCFP-blasti and transfected HEK 293 cells (human embryogenic kidney cells), you observed, using confocal microscopy that the GFP fluorescence displays a reticulate network pattern in the cytoplasm of the cells. Describe an approach you can use to determine the subcellular localization of the Sonic Hedgehog-GFP fusion protein.