The chart can be used to determine the amino acid that a specific codon encodes.FinlSecond LetterThindLetterUсAGphenylalanine serinetyrosinecysteineUphenylalanine serineUtyrosinecysteineсleucineserinestopstopAleucineserinesloptryptophanGleucineprolinehistidinearginineUleucineprolinehistidinearginineсleucineprolineglutaminearginineAleucineprolineglutaminearginineGisoleucinethreonineasparagineserineUisoleucinethreonineasparagineserineCisol cinethreoninearginineA(start)lysinelysinethreoninearginineGvalinealanineaspartateglycineUvalinealanineaspartateglycineCvalinealanineglutamateolycineAvalinealanineglutamateglycineGIf a strand of DNA had the sequence GACTTC, then mutated to be GACATC, what sequence of aminoacids would be formed?Aspartate and phenyalanine become apartate and isoleucineLeucine and lysine become leucine and tyrosineAspartate and phenyalanine become aspartate and methionineLeucine and lysine become leucine and stopCA

Answered: Image /qna-images/answer/1e681997-9dec-4706-a675-fd80a4b460dc.jpg

Answered: Aspartate and phenyalanine become…

Science

Biology

Aspartate and phenyalanine become apartate and isoleucine

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Related questions

Q: If a cell is deficient of REC8, how would this affect the chromosome movement during mitosis and…

A: REC8 is a very important component of meiosis specifically the prophase It forms the pro phase…

Q: In guine pigs, rough coat (R) is dominant to smooth coat (r). What is the expected percentage of…

A: ANSWER';- 50% Explain;- A heterozygous guinea pig (Rr) and homozygous passive guinea pig (RR) have a…

Q: 21. During which phase of the cell cycle does DNA synthesis take place? A. Anaphase B. Metaphase C.…

A: A cell cycle is a series of activities that take place within a cell as it grows and divides. The…

Q: 4) Which do you believe has a better impact on health: macronutrients or micronutrients? Explain…

A: NUTRIENTS: The chemical substances required by an organism for its growth, survival, and…

Q: Allan, a 12th grader, had pancit for lunch. Later on, he observed some itchiness and rashes on his…

A: * Allergies are nothing bur your bodys reaction to harmless substance like pollen grains and molds…

Q: What molecules are released by activated helper T cells? Note: This is a multiple question, choose…

A: As they are necessary for practically all adaptive immune responses, helper T cells are perhaps the…

Q: The mouse REST gene is under the control of a promoter region which contains alternative promoters.…

A: Ribosomes perform an important function in protein biosynthesis in the cytoplasm. The mRNAs that are…

Q: Arecaceae or the palm family has a tropicopolitan distribution with some extensions in the…

Q: 3. In radishes, flower color may be red, purple or white. The edible portion of the radish may be…

Q: 15. differntial splicing allows a single gene to produce multiple proteins true or flasev

A: Alternative Splicing or Differential Splicing enables the inclusion or exclusion of particular exons…

Q: Describe the effects of streptococcal haemoysins giving an example of streptococci that can manifest…

A: A "microbe" is a living entity that is so tiny that it cannot be seen with the naked eye.…

Q: formation of different cellular phenotypes is due to the equal distribution of the cytoplasmic…

A: Phenotype shows the appearance of individual. genotypes shows the genetic type.

Q: tight packing of previously less condensed chromatin identify which describes the statement…

A: Post translational modifications in histone proteins can change the shape of chromatin, which can…

Q: female calico cat has patches of black and white due to random x-chromosome inactivation a.…

A: * Calico cats are always femal and they will displays red and black based colors depends on which…

Q: Describe and discuss the concepts of plant growth, development, reproduction, and the basic…

A: All living organisms have the ability to reproduce and grow. Mitosis is the process through which…

Q: oxytocin gene due to methylation. II. Mice with hypermethylation of the agouti gene became obese and…

A: Membrane fracturing, physical or pharmacological opening of the cervix, and oxytocin injection,…

Q: . rat liver mannan-binding protein gene yields two different mRNA sizes 1.4 and 3.5 kb identify…

A: Pre transcriotion contol involved in DNA methylation and chromatin packing . Transcription control…

Q: Q4/ What is Osteoporosis disease? Explain the pharmacist role in giving the suitable prescriptions…

A: Across most vertebrate animals, a bone is a hard organ that is part of the skeleton. Bones protect…

Q: How are concatemers of the Herpes Virus resolved to make sure only a single copy of the genome is in…

A: Herpes virus is very notorious for causing various types of infections which are very hard to treat…

Q: RNAi (or RNA interference) is the process of creating double-stranded RNA in the cells. Explain how…

A: * RNA interference (RNAi) also called as Post Transcriptional Gene Silencing whi h is an conserved…

Q: 5. In corn plants, a dominant allele I inhibits kernel color, while the recessive allele i permits…

Q: WHAT IS Humoral Immunity

A: Active immunity is the immunity induced in entities by the exposure of antigens. It is mediated by…

Q: in m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region…

A: Transcription is the process of formation of transcript that is mRNA from DNA. It is catalysed by…

Q: How many μ moles of acetaldehyde are required to allow complete oxidation of the pyruvate to 15µ…

A: the limited supply of NAD+ will deplete the reaction initially causing the reaction to stop, but…

Q: The following truncated sequences are the receptor binding domain of COVID19’s & SARS’ S-protein,…

A: A virus's receptor-binding domain (RBD) is a critical component of the virus's'spike' domain that…

Q: 1. Epigenetic marks established at infancy will persist throughout an individual's lifespan. II.…

A: As a result, vitamins and biologically active components can transiently modify DNA methylation…

Q: Identify what is being described by each of the following statements. Write your best answer on the…

A: Evolutionary studies Evolution is the change in characteristics over time to survive and reproduce…

Q: If you had a template sequence of AACCGTTA, how many flushes of nucleotides would it take to get the…

A: DNA sequencing is a process which encompasses biochemical methods gor determining the order of the…

Q: Hello! What are the two drugs that have potential for treating Alzheimer’s diseases? And compare…

A: Answer :- The two drugs that have potential for treating Alzheimer’s diseases are :- -…

Q: DODO 0 0 Consider the characteristics given on the first column of Table 18. Put a check on the…

A: When researching biological entities, following a predefined hierarchy and order makes it easier to…

Q: Discuss the coevolution of polydnaviruses and their mutualistic partners

A: Introduction Polydnaviruses are insect viruses that belong to the Polydnaviridae family. The family…

Q: In humans, the genes for red-green color blindness (R = normal, r = color blind) and hemophilia A (H…

A: Given: In humans, The genes for red-green color blindness (R = normal, r = color blind) and…

Q: 2.If Peter is allergic to peanuts and Paul is not, what is the precise molecular difference in…

A: 2. If Peter is allergic to peanuts and Paul is not, what is the precise molecular difference in…

Q: In addition to phagocytosis, neutrophils use a process called NETs. Which one of the following…

A: Introduction NETs were first described as a type of innate pathogen defence system that may trap…

Q: cell determination is the expression of the cell's specialized role true or false

Q: In ELISA, what is the importance of washing? When does washing is performed?

A: Introduction :- Enzyme-linked immunoassay (ELISA) is an acronym for enzyme-linked immunoassay.…

Q: Questions 3 and 4 refer to the following diagram. Tertiary Consumer Snake Secondary d Consumer Toad…

A: The strata is very important in various ecological cycles as it keeps the consumers and producer…

Q: 1) RNA polymerase 2) sigma (o) subunit of RNA polymerase 3) rho (p) factor 4) transcription factors…

A: RNA polymerase extend or polymerise RNA. Sigma subunit of RNA polymerase binds to promoter…

Q: . heterochromatic regions decondense for gene expression a. pre-transcriptional control b.…

A: Heterochromatin regions are condensed regions of the chromatin that are transcriptionally switched…

Q: For each protein, identify the following: If the protein is an integral, peripheral, or amphitropic…

A: * Integral monotopic proteins will permanently attached to membrane from one side only then it is…

Q: A massive die-off of lobsters in the Long Island Soundwas blamed on pesticides sprayed to control…

A: Introduction Mosquitoes belong to the Culicidae family, which contains almost 3,600 species of tiny…

Q: Two different species of bacteria are growing together in a mixed biofilm in the intestine of a…

A: Autoinducer-2 (AI-2) is a signal molecule produced by LuxS, an enzyme found in many bacterial…

Q: 13.Why does carbon dioxide need to be transported in the form of bicarbonate ions? (This is multiple…

A: The transport of gases takes place via the blood from the lungs to tissues and vice versa. The O2 is…

Q: enzymes ECORI and HINDIII are called "compatible" enzymes. DNA cut with these enzymes can be ligated…

A: Restriction Endonucleases Restriction endonucleases or restriction enzymes are the enzymes that can…

Q: 9.Statement 1: Major histocompatibility complex proteins help the immune system recognize 'self' vs…

A: Immunity deals with the study of how body's immune system works against foreign pathogens to…

Q: 5. In mice, black color (B) is dominant to white (b). At a different locus, a dominant allele (A)…

A: Phenotype is the physical look of a bodily character. Phenotypic ratio refers to the rate or…

Q: 13. The presence of freckles (F) is dominant to no freckles (f). Jake and his mom have freckles, but…

A: Introduction The term "genotype" refers to an organism's whole complement of genes; in other words,…

Q: DNA replication is fast, virtually error-free, and coordinated with cell division. Discuss which of…

A: DNA replication is fast:- DNA replicates at a rate of 50 nucleotides per second. In both cases,…

Q: Define death in physiological terms. We know that when the human heart stops beating, it can be…

A: The cardiovascular system is a network of arteries and veins in which the heart pumps blood. One of…

Q: Enzyme B requires Zn2+ (Zinc ion) to be functional. Zn2+ is a Cofactor O Product O Coenzyme O…

A: Coenzymes are chemical molecules that are needed for enzymatic performance by numerous enzymes.…

Concept explainers

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.

Question

The chart can be used to determine the amino acid that a specific codon encodes.
Finl
Second Letter
Thind
Letter
U
с
A
G
phenylalanine serine
tyrosine
cysteine
U
phenylalanine serine
U
tyrosine
cysteine
с
leucine
serine
stop
stop
A
leucine
serine
slop
tryptophan
G
leucine
proline
histidine
arginine
U
leucine
proline
histidine
arginine
с
leucine
proline
glutamine
arginine
A
leucine
proline
glutamine
arginine
G
isoleucine
threonine
asparagine
serine
U
isoleucine
threonine
asparagine
serine
C
isol cine
threonine
arginine
A
(start)
lysine
lysine
threonine
arginine
G
valine
alanine
aspartate
glycine
U
valine
alanine
aspartate
glycine
C
valine
alanine
glutamate
olycine
A
valine
alanine
glutamate
glycine
G
If a strand of DNA had the sequence GACTTC, then mutated to be GACATC, what sequence of amino
acids would be formed?
Aspartate and phenyalanine become apartate and isoleucine
Leucine and lysine become leucine and tyrosine
Aspartate and phenyalanine become aspartate and methionine
Leucine and lysine become leucine and stop
C
A

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF?
Please by using the first base of each as the first triplet in a condo, how do I translate two almost identical RNA strand into sequences? You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?
Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?
Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. Example: (USE SPACES BETWEEN CODONS): ' XXX XXX XXX XXX ' Example: (USE SPACES BETWEEN AMINOACIDS): Polypeptide: direction-XXX-XXX-XXX-direction ATG GCA TGC AAT AGC TCA TGC b) What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A? (3
look at the code: import random # Define the DNA nucleotidesnucleotides = ["A", "T", "G", "C"] # Define the codon-to-amino acid dictionarycodon_table = { "AUG": "M", # Start codon "UUU": "F", "UUC": "F", "UUA": "L", "UUG": "L", "UCU": "S", "UCC": "S", "UCA": "S", "UCG": "S", "UAU": "Y", "UAC": "Y", "UAA": "*", # Stop codon "UAG": "*", # Stop codon "UGU": "C", "UGC": "C", "UGA": "*", # Stop codon "UGG": "W", "CUU": "L", "CUC": "L", "CUA": "L", "CUG": "L", "CCU": "P", "CCC": "P", "CCA": "P", "CCG": "P", "CAU": "H", "CAC": "H", "CAA": "Q", "CAG": "Q", "CGU": "R", "CGC": "R", "CGA": "R", "CGG": "R", "AUU": "I", "AUC": "I", "AUA": "I", "AUC": "I", "ACU": "T", "ACC": "T", "ACA": "T", "ACG": "T", "AAU": "N", "AAC": "N", "AAA": "K", "AAG": "K", "AGU": "S", "AGC": "S", "AGA": "R", "AGG": "R", "GUU": "V", "GUC": "V", "GUA": "V",…
Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code c. Nonoverlapping code d. Initiation codon e. Termination codon f. Sense codon g. Nonsense codon h. Universal code i. Nonuniversal codons 6. How is the reading frame of a nucleotide sequence set?