What is colon cancer what is the cause symptoms and cure of it ? One paragraph

Q: true or false  Human ILC3 can be further divided into two subsets based on expression of the…

A: Interleukins are a broad set of chemical messengers that have a variety of roles in the immune…

Q: some of the above choices are strict aerobes and some are facultative anaerobes. This is helpful to…

A: Bacteria are single celled organism find in everywhere on earth. Bacteria are classified into gram…

Q: In the garden pea, round seeds are dominant over wrinkled seeds. An investigator crosses a plant…

A: Given :-  Total count of offspring is 1000 R( Round ) and r( wrinkled) Heterozygous dominant and…

Q: 1. List 3 sustainable practices for a healthy future and healthy environment. 2. Write 3 ways these…

A: 1- Don't throw garbage on street. Always carry a bag for your garbage or throw garbage in public…

Q: 1A. If Creb upregulates gene T with acetylcholine stimulation, what happens to T when cAMP…

A: All cells receive and respond to signals from their surroundings. This is acomplished by a variety…

Q: 3d bioprinting systems, biomaterials, tissue engineering. Indicate 3 creative project topics on the…

A: 3d bioprinting :  The process that utilizes the living cells along with the biomaterial to produce…

Q: List five (5) factors affecting fixation of the cells in a physical and chemical state

A: Fixation: Fixation is a procedure in which cells or tissue are fixed partially in a chemical and…

Q: What happens in the cell eventually after signals are transduced?

A: Cells communicate with each other via released proteins unique to each kind. Cell signaling can be…

Q: turtles, lizards, snakes crocodiles dinosaurs parental care keratinized skin amniote egg bipedalism…

A: Phylogenetic tree is a graphic representation of the course of evolution.It provides a way to…

Q: Which of the following specifically explains why glucose uptake into intestinal cells happens in…

A: Absorption is the process by which the end products of digestion pass through the intestinal…

Q: An individual with XY chromosomes produces gametes where 50% have an extra sex chromosome and 50%…

A: Please follow step 2 for detailed explanation.

Q: Which of the following is NOT a role for tissue-residebnt macrophages in maintaining homeostasis?…

A: Answer: Macrophages carry out crucial tissue-specific tasks and defend the organism from infection,…

Q: Where does the following reaction take place: isomerization of the 6-carbon molecule citrate Select…

A: The production of intermediate cis-aconitase converts citrate to isocitrate.This is a reversible…

Q: A single glucose molecule can drive the citric acid cycle ...... one turn 2 turns 3 turns  or 4…

A: Citric acid cycle is a sequence of chemical events that take place inside all the aerobic organisms…

Q: explain and proivde anylyses what are the diagnoses and current and potential future treatments for…

A: adenocarcinoma tumors colorectal cancer  (colon)  can be diagnosed by following tests 1. Blood test-…

Q: List the types of adult tissues that are derived From each these > OF germ layers!

A: INTRODUCTION Three layers of germ cells Outer Ectoderm, middle mesoderm and inner endoderm.

Q: Discuss how meiosis and the events in meiosis explain Mendel’s laws.

A: Meiosis It refers to the cell division that occurs in sexually reproducing organisms that decreases…

Q: constriction of a blood vessel to one-half of its resting diameter would increase its resistance to…

A: The answer is 16.

Q: The type VI secretion system evolved from: please explain and choice the right answer  porins…

A: Introduction Bacteria belongs to the kingdom Monera. Bacteria are unicellular and prokaryotic…

Q: lymph node traps antigens, make an analogy of the lymph node’s method of action and a busy highway…

A: The Immune System consists of many "cells" and chemicals that defend our bodies against infections.…

Q: Victim DNA Sperm sample Suspect 1 Suspect 2 Based on the DNA profile in the image on the right,…

A:

Q: 8. Name the six classes of enzymes and type of reaction envolve.

A: Note: As per guidelines we can solve one question at a time.ask rest questions to get answer!!…

Q: A given substance would require active transport across a lipid bilayer into a cell if... (choose…

A: There are various means of transport that are used to carry out transportation in plant and animal…

Q: Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang?   AccI GT^CGAC…

A: Restriction enzymes are the specific enzymes that recognize and cut at specific sites on nucleotide…

Q: Explain how metaphase of mitosis is different from metaphase I of meiosis.

A: There are two types of cell divisions which are involved in the distribution of genetic material…

Q: what is the answer?

A: Cell division is a process by which parental cells divide themselves to form daughter cells. It is…

Q: Acetyl Coa is a ____ carbon molecule derived from pyruvate that is used during ______. Select one:…

A: The aerobic respiration process breaks down the glucose into ATP.

Q: What is the percentage strength (v/v) if 225 g of a liquid having a specific gravity of 0.8 is added…

A: The answer is 18.75%

Q: 10) Discuss how SSRI's and MAOI's function in the brain to alleviate depression symptoms. Explain…

A: Introduction Many persons with addiction and co-occurring depression benefit greatly from medication…

Q: 3 in 3' 5' 5' 3'

A: * DNA replication is a process in which, double stranded DNA will be copied to produce two identical…

Q: The SecB protein helps export proteins by:

A: In molecular biology, molecular chaperones are proteins that help big proteins or macromolecular…

Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…

A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…

Q: Glycolipids and glycoproteins on membranes are most directly involved in _____________. Select one:…

A: Glycoproteins are chemical molecules made of a protein and a carbohydrate bound together, whereas…

Q: Enzymes catalyze a chemical reaction by A. decreasing the amount of ATP required to activate a…

A: Enzyme is a protein is a substance. Friedrich Wilhelm Kuhne was the one who coined the term ' Enzyme…

Q: Samples of three different triglycerides, A, B, and C, were tested to determine the melting point of…

A: A graph of melting point of three triglycerides are given in the question and by analysing the…

Q: It is in the plants that mature cells can revert to what undifferentiated state?  A. callus B.…

A: Differentiation of cells is a process in which cells changes to become mature cells to perform more…

Q: Liver 1. Explain what it means for bile to emulsify fat ? 2. Where is boiled stored ? 3. What does…

A: The digestive system helps digest food to micronutrients, which are absorbed by the body. And…

Q: Glucose represents ______________ energy that will become ____________ in respiration. Select one:…

A: 1. Glucose represents the potential energy that will become oxidized in respiration. option A.…

Q: Which is not a lifestyle change recommended with a diabetes diagnosis? Group of answer choices…

A: Introduction :  Insulin is a hormone secreted by the pancreas that regulates the sugar level in the…

Q: In the following diagram, indicate the color of the xylem, phloem, cortex, epidermis and endodermis,…

A: Plants are multicellular , eukaryotic, photosynthetic structure that belongs to kingdom Plantae.…

Q: If you were to sequence a human genome today, how would the sequencing differ from that done during…

A: Genomics is the study of genomes through analysis, sequencing and mapping of genes and non-…

Q: 22. VIRAMUNE Oral Suspension contains 1% w/v of nevirapine. Calculate the milli- grams of nevirapine…

A: VIRAMUNE: Nevirapine (NVP), marketed among other names as Viramune, is a drug intended to treat and…

Q: Demonstration of Osmosis using Potato Osmoter 1. Where was the liquid cavities of some of the…

A: Introduction: The osmosis phenomena in living plant cells is demonstrated using a potato osmometer.…

Q: 16. What is the membrane potential when the ratio of the ion concentration values is X-1) / X.

A: The resting membrane potential, also known as the resting potential, is a voltage across the…

Q: 1. What are enzymes? 2. Why are they catalysts? 3. How many digestive enzymes does the body produce?…

A: Every living cells perform different activities that keeps the cell alive. Difficult different…

Q: Observe the species in your surroundings, take a picture of the leaves of at least three plant…

A: In given question three type of leaves given of Aloe Vera,organo and Banana leaves. Base is bottom…

Q: Lower birth rates and declining family size in recent years reflect what pheno

A: I think the question meant- Lower birth rates and declining family size in recent years reflect…

Q: 1.What is the official genename of the gene? Do you have another names?

A: The gene is formally represented by the suggested name. However, a particular gene has frequently…

Q: 24. In Drosophila melanogaster, ebony body (e) and rough eyes (ro) are encoded by autosomal…

A: Introduction :- A given gene is said to be autosomal if it is located on a numbered chromosome…

Q: The sodium-glucose cotransporter is an example of _____________.  The Na/K pump participates in…

A: Cell membrane is being a semi- permeable in nature selectively allows the substance to move in and…