What is one advantage or Transcription and translation can occur simultaneously It provides an effective genomic structure for regulating multiple genes in operons It allows multiple protein products to be formed from one gene, via alternative splicing All of the above A and B only

What is one advantage or Transcription and translation can occur simultaneously It provides an effective genomic structure for regulating multiple genes in operons It allows multiple protein products to be formed from one gene, via alternative splicing All of the above A and B only

Name: Can you help find one advantage of having genes broken up? What is one
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Can you help find one advantage of having genes broken up? What is one advantage of having genes broken up into multiple exons, with regard to eukaryotic gene structure?Transcription and translation can occur simultaneouslyIt provides an effective ge

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and2 are 546 bp and 466 bp respectively.a. Draw this gene showing the promoter, exons, introns and transcription initiationsites.b. This gene is found to encode two mRNAs. One of these mRNAs is 224 bp in shorter thanthe other.i. What is the biological process giving rise to this phenomenon called?What are the sizes of the two mRNAs (in bp) produced from this gene?
GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH IS THE mRNA AND THE POLYPEPTIDE THAT IS FORMED FROM THE SEQUENCE DNA 5' atgagtaaagga 3'
The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.
The template strand of a gene contains the following sequence: 3'-TAC TTG TCC GAT ATC-5' Following a mutation, the sequence is modified for this one: 3'-TAC ATG TCC GAT ATC-5' Draw the sequence of a.a. encoded for each of the strands. What is the effect of this mutation on the sequence amino acids (specify type of mutation)
Since the above Alu sequence used to code for a functional protein in the past, but no longercodes for a functional protein at the present time, it is most properly defined as:A. a variable repeat nucleotide polymorphismB. a pseudogeneC. euchromatinD. an exonE. a codon
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand? c. Where, approximately, will the transcription start site be?
The following is a list of mutations that have beendiscovered in a gene that has more than 60 exons andencodes a very large protein of 2532 amino acids.Indicate whether or not each mutation could cause adetectable change in the size or the amount of mRNAand/or a detectable change in the size or the amountof the protein product. (Detectable changes in size oramount must be greater than 1% of normal values.)What kind of change would you predict?a. Lys576Val (changes amino acid 576 from lysineinto valine)b. Lys576Argc. AAG576AAA (changes codon 576 from AAG toAAA)d. AAG576UAGe. Met1Arg (at least two possible scenarios exist forthis mutation)f. promoter mutationg. one base pair insertion into codon 1841h. deletion of codon 779i. IVS18DS, G–A, + 1 (this mutation changes thefirst nucleotide in the eighteenth intron of the gene,causing exon 18 to be spliced to exon 20, thusskipping exon 19)j. deletion of the poly-A addition sitek. G-to-A substitution in the 5′ UTRl. insertion of 1000 base…
When the sequence CpG occurs, the cytosine can be methylated. If a methylated cytosine is then deaminated, it will be mutated to ["adenine", "thymine", "uracil", "guanine"] . As a result, CpG sequences are underrepresented in the genome. The presence of a CpG island at a particular location suggests that the location might be a(n) ["exon", "promoter", "enhancer", "intron", "telomere"] . Pick answers within quotation marks to fill in the blanks.
Even though the lac Z, Y, and A structural genes are transcribed as a single polycistronic mRNA, each gene contains the initiation and termination signals essential for translation. Predict what will happen when a cell growing in the presence of lactose contains a deletion of one nucleotide (a) early in the Z gene and (b) early in the A gene.
Genes can be transcribed into mRNA, in the case of protein coding genes, or into RNA, in the case of genes such as those that encode ribosomal or transfer RNAs. Define a gene. For the following characteristics, state whether they apply to (a) continuous, (b) simple, or (c) complex transcription units.i. Found in eukaryotesii. Contain intronsiii. Capable of making only a single protein from a given gene
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
This chapter describes different types of TEs, including insertionelements, simple transposons, LTR retrotransposons, and non-LTRretrotransposons. Which of these four types of TEs have the followingfeatures?A. Require reverse transcriptase to transposeB. Require transposase to transposeC. Are flanked by direct repeatsD. Have inverted repeats