Which of the following processes degrades mRNA molecules after transcription if they have a sequence complementary to a small non-coding RNA? O A. RNA blocking B. RNA interference OC.post-translational modification O D. Alternative splicing
Q: Which of the following statements are true about eukaryotic mRNA?a. The sigma factor is essential…
A: Proteins within the human body are made up of a small chain of building blocks, which are termed as…
Q: The -35 and-10 consensus sequences upstream from the transcription start site are A) O located in…
A: Transcription is the process of formation of mRNA (messenger ribonucleic acid) from the DNA…
Q: The function of the genetic code is toa. promote transcription.b. specify the amino acids within a…
A: Genetic code is a set of rules used by living organism’s cells in the process of translation that is…
Q: If a mutation deletes the start codon in a eukrayotic gene, which of the following most accurately…
A: The start codon is a three-nucleotide long sequence in a gene that is responsible for the initiation…
Q: Which of the following statements about the transcription process is correct?
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: If a mutation deletes the promoter in a eukrayotic gene, which of the following most accurately…
A: mRNA means messenger RNA. mRNA forms from the template DNA strand. The template DNA strand is used…
Q: The stage of transcription where mRNA is synthesized is called (a) initiation (b) elongation…
A: TRANSCRIPTION The Formation of RNA from the DNA is termed as Transcription. The RNA formed after…
Q: What will result from the binding of a transcription factor to an enhancer region? a. decreased…
A: Introduction: To initiate transcription in the eukaryotic cell, RNA polymerase should bind to the…
Q: During elongation (in transcription), RNA polymerase has three prominent channels, or grooves. These…
A: Gene expression is the process by which information from a gene is used in the synthesis of a…
Q: what is the translation factors(s) most involved in decoding a) IF1,IF2,IF3 b) N-fMet-tRNAfMet…
A: Protein synthesis or translation complete in three step - initiation, elongation and termination.…
Q: Post-translational modifications of proteins can affect which of the following? a. protein function…
A: When RNA has been transported to the cytoplasm, it is being translated into protein whose control is…
Q: Give two DIFFERENT examples of how the following can occur: a. A point mutation in an exon that is…
A: Silent mutation - Silent mutations are mutations in DNA that do not have an observable effect on the…
Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…
A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…
Q: Which of the following mechanisms do prokaryotes use to produce different prdtein products from a…
A: In prokaryotes, the genes encoding proteins of related functions are transcribed under the control…
Q: Some events that take place in proteins synthesis are shown below: A. An enzyme reads the gene…
A: TRANSCRIPTION It is the process of transfer of sequence information from DNA to RNA . The DNA…
Q: The portion of the mRNA transcript that gets removed duringRNA processing is thea. exons.b.…
A: Ans: RNA processing: The post transcription processing in eukaryotes is referred to as RNA…
Q: Which of the following is least related to the other items? A. RNA Polymerase B. transcription…
A: Transcription It is defined as the process of production of RNA sequence from the DNA sequence. The…
Q: The primary function of RF1 during translation is to: a. recognize a stop codon in the 70S A…
A: The translation is the process of translating genetic information in the form of proteins. It…
Q: What is one function of the 5' cap in eukaryotic mRNA? Select one: a. It is involved in translation…
A: Transcription is the process in which the RNA is synthesised from the DNA that is present in the…
Q: Ribosomes that are translating a mRNA, would release that mRNA when they reach a) an operator b) a…
A: Introduction :- Ribosomes have two primary functions: message decoding and peptide bond synthesis.…
Q: Which one is not a part of the transcription unit? a) RNA primase b) Promoter c) RNA coding sequence…
A: Deoxyribonucleic acid (DNA) is a double stranded helical genetic material containing thousands of…
Q: In prokaryotes, control of gene expression usually occurs at the a. splicing of pre-mRNA into…
A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…
Q: A prokaryotic gene was transcribed then trans antibiotics X was added, and the products of t steps…
A: Antibiotic are the key substances which act on the major pathways of replication, transcription or…
Q: Which of the following functions is NOT typically attributed to small nuclear RNA (SNRNA)? A)…
A: Ribonucleic acid is a complex of the high molecular weight molecule that participates in cellular…
Q: Which type of molecule binds at the core promoter sites in association with RNA polymerase? A…
A: RNA polymerase can attach to the polymer by only one method. This method involves binding of Basal.…
Q: Which of the following is true regarding General transcription factors? a. Act at every gene for a…
A: Transcription factors are proteins which binds to DNA, resulting in regulation of gene expression…
Q: During transcription in eukaryotes, the 5' cap and poly-A tail function to: A. Protect mRNA from…
A: After transcription primary mRNA formed mature mRNA which has different part to help in protein…
Q: Translation can be regulated by a. translational repressors. b. antisense RNA. c. attenuation. d.…
A: The translation is the term for the synthesis of a polypeptide chain from the decoding of…
Q: . differential lengths of poly-A tails affect mRNA stability a. pre-transcriptional control b.…
A: In the cytoplasm, the poly(A) tail interacts with the 5′ end of mRNA via eIF-4G, which binds both…
Q: Which of the following is LEAST likely to be transcribed into RNA? a) introns O b) promoters &…
A: Transcription is the process of conversion of DNA molecule into messenger RNA.
Q: Which of the following events has nothing to do with the mechanism known as "RNA interference"? Q a…
A: RNA interference means the silencing of the genes or gene expression is suppressed. RNA interference…
Q: Which of the following is a function of the 7-methylguanosine cap? a. Exit of mRNA from the nucleus…
A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…
Q: In which of the following does nitrogenous base pairing (base complementarity via hydrogen bonds)…
A: Nitrogenous base pairing can include DNA-DNA, DNA-RNA, RNA-RNA pairing. Both DNA and RNA are made up…
Q: During the initiation stage of translation in bacteria, which of the following events occur(s)? a.…
A: The mRNA (messenger ribonucleic acid) contains the genetic information for the protein synthesis. A…
Q: Below is a picture of multiple mRNA molecules being transcribed simultaneously from the same…
A: mRNA transcription and translation occurs at same time in prokaryotes(polycistronic) while in…
Q: you think the process could be regulated? Select all that apply: a) Before transcription begins.…
A: Gene expression is the process by which information from a gene is synthesised. The synthesis of a…
Q: Which of the following mutations would be most likely to havea harmful effect on an organism?(A) a…
A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while copying…
Q: What happens immediately after the initiation complex forms during translation? (a) peptide bond…
A: Translation is biological process which involves protein synthesis with the help of mRNA i.e.…
Q: In eukaryotic cells, transcription cannot begin until(A) the two DNA strands have completely…
A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…
Q: A given coding strand sequence in a Eukaryote is as follows 5'GGGAATATAA GACCGATGGA GGGTACAG…
A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…
Q: What factors are utilized by the cell in order to recognize the stop codon and disassemble the…
A: Translation is the process of synthesizing protein from mRNA and catalytic environment is provided…
Q: how does the E.coli RNA polymerase find the gene's promoter to be transcribed? A. the TATA…
A: The transcription of DNA into RNA is catalyzed by DNA dependent RNA polymerase enzyme. There are…
Q: what is the first event to take place in translation in eukaryotic cell? a. An clongation of the…
A: Translation is the process which is responsible for synthesis of protein from the mRNA.
Q: Which of the following are examples of RNA modification? a. Splicing b. Capping with…
A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…
Q: Which of these is the function of a poly (A) signal sequence? A. It adds the poly (A) tail to the 3'…
A: In the yeast the poly (A) signal sequences are present which are short sequences and redundant in…
Q: Below is a representation of a pre-mRNA. Numbers represent exons, and letters represent introns:…
A: Transcription is a process through which the doucle stranded DNA transcribes itself into a single…
Q: Which of the following statements about RNA processing in eukaryotes is INCORRECT? A. The excision…
A: The pre mRNA is converted into mrna before it's exist outside the nucleus in eukaryotes.
Q: The process of RNA interference may lead toa. the degradation of an mRNA.b. the inhibition of…
A: Translation is the process by which polypeptides are synthesized from a mRNA transcript which is…
Q: Which of the following is involved in pre-transcriptional gene regulation? a.) alternative splicing…
A: Transcription is a process of converting the genetic information in the DNA to RNA in the nucleus of…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Portions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps c. poly-A tails d. intronsPromoters are DNA sequences a. near a transcription start site b. bound to a repressor protein c. that inhibit transcription of a gene d. that stimulate ncRNA activityThe portion of the mRNA transcript that gets removed duringRNA processing is thea. exons.b. introns.c. poly-A tails.d. 5′ caps.e. spliceosomes.
- The stage of transcription where mRNA is synthesized is called (a) initiation (b) elongation (c) termination (d) post transcriptional modification (e) none of the aboveA binding site for RNA polymerase is called a .a. gene c. codonb. promoter d. proteinThe splicing process a. occurs in prokaryotes. b. joins introns together. c. can produce multiple mRNAs from the same transcript. d. only joins exons for each gene in one way.
- In RNA silencing, siRNAs and miRNAs usually bind to which part of the mRNA molecules that they control? a. 5′ UTR b. Coding region c. 3′ poly(A) tail d. 3′ UTRWhich of the following is involved in pre-transcriptional gene regulation? a.) alternative splicing b.) DNA methylation c.) micro RNA d.) histonesChoose all items that regulate the transcription of mRNAs.Group of answer choices A. Transcription factor proteins B. Intron sequences C.. DNA promoter sequences D. DNA enhancer regions E. Exon sequences
- During elongation (in transcription), RNA polymerase has three prominent channels, or grooves. These channels provide sites for all of the following EXCEPT ___. A. A site for the entry of RNA nucleotides B. A site for the growing RNA strand to exit C. A site for the double-stranded DNA molecule it is transcribing D. A site for the entry of amino acidsDuring the transcription of DNA to mRNA, __________. Group of answer choices a) RNA polymerase moves along the DNA (reads) in the 5’ to the 3’ direction b) the 3’ end of the mRNA molecule is produced first c) RNA polymerase must first bind to a promoter sequence d) transcription is initiated at a “start codon”Which of the following is NOT TRUE about Eukaryotic Transcription: A. Occurs in the cytoplasm B. Pol II has 12 subunits C. Pol III transcribes tRNA genes D. It’s controlled by Cis-acting sequences E. Leads to specialization of cell function