Please answer the following 4 questions and answer very short and briefly What is the anticodon that would pair up with the MRNA codon UAG?3In What part of the cell is messenger RNA created?Why do Transfer RNAs put their amino acids in a particular order?What is the definition of a protein?

The central dogma of molecular biology includes replication, transcription and translation. Between…

What is the anticodon that would pair up with the MRNA codon UAG? In What part of the cell is messenger RNA created? Why do Transfer RNAs put their amino acids in a particular order? What is the definition of a protein?

What is the anticodon that would pair up with the MRNA codon UAG? In What part of the cell is messenger RNA created? Why do Transfer RNAs put their amino acids in a particular order? What is the definition of a protein?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Related questions

Q: For each statement describing hormonal effects, identify the hormone(s) involved by choosing a…

A: Key A s.no. Key B Basal metabolic harmone 22 (T4 ,T3) 1 L (thyroid gland) Programming of T…

Q: Determine the reason behind the penicillin enrichment.

A: The genes are a series of nucleotides found on chromosomes that code for a particular protein that…

Q: Explain with reason the features of the human pedigree which indicate that a mutation at…

A: The heart of the cell's power is its mitochondria. It has mtDNA, or mitochondrial DNA, which is its…

Q: Which genotype below is considered a carrier for an x-linked recessive disorder? a C XBXB xBxb xbxb

A: X-linked recessive disorder - Genetic disorders connected to mutations in genes on the X chromosome…

Q: A DNA nucleotide triplet that codes for the amino acid alanine is a. CCA b. CGG C. CCU d. CGU

A: Introduction The molecule that carries the genetic information necessary for an organism's growth…

Q: CASE

A: Concept used: Transport in cells Important definition: Transport in cells - The cell is the…

Q: During meiosis in male mammals, sex chromosomes segregate to produce two types of sperm: X‑bearing…

A: In mammals sex determination is male heterogametic type in which the male produces two types of…

Q: Explain the mechanism/s through which molecules such as cyanide and rotenone can exert a cytotoxic…

A: The term "cyanide" refers to any chemical containing a carbon-nitrogen (CN) bond. Many substances…

Q: Define biology

A: Science is the study of nature, the way natural things behave, and how they actually work in the…

Q: A cross between an orange-brown male and a homozygous black female produce four kittens. What is the…

A: Given information The cross is between an orange-brown male and a homozygous black female. Black…

Q: Germination of seeds explanation for assignment

A: The ripened or matured ovule of a flowering plant, which contains an embryo and capable of…

Q: Could monkeypox turn into a pandemic

A: Monkeypox is the latest global public health threat caused by the monkeypox virus. The monkeypox…

Q: ACTIVITY :- Prepare a flow chart on type of Microorganisms and draw suitable labelled diagram and…

A: Introduction Microorganisms are small organisms that are not seen by the naked eyes. They are…

Q: As part of any scientific study, a scientist will only change one dependent variable at one time.…

A: Dependent and independent variables Dependent variables are those that depend on some other…

Q: Question 33 (1 point) ✓ Saved Which of the following reactions is catalyzed by carbonic anhydrase?…

Q: What is scientific consensus

A: Basically, a consensus defines a general agreement on a particular subject or matter. A example of…

Q: Question 9 Fern "trees" can occur whereas moss "trees" do not because Oferns do not require swimming…

A: Botany, a subfield of biology, is the study of plants. It is also known as plant science, plant…

Q: What is the equation that represents the mass balance of the exponential phase of bacterial growth?…

A: In exponential growth, a population's per capita (per individual) growth rate stays the same…

Q: Which Gene encodes for the Lac Repressor that binds on the Lac Operon Operator. O Lac Z gene O Lac Y…

A: The lactose operon (also known as the lac operon) is a set of genes that are specific for uptake and…

Q: Solve the following problem: 34,000 bacteria/l have been measured 4 hours after inoculating a…

A: Given information Bacterial population after 4 hours of inoculation= 34,000 bacteria/l Bacterial…

Q: What does RNA polymerase transcribe from the Lac Y gene on the lac operon? O beta-galactosidase O…

A: Lac Operon is a set of genes that are transcribed by the RNA polymerase which are solely responsible…

Q: Moving to another question will save this response. Question 10 This plant community covers about…

A: Introduction :- A wetland is a unique environment that experiences seasonal or constant flooding…

Q: The ability to taste the compound PTC is controlled by a dominant allele T, while individuals…

A: In this question, Hardy Weinberg equilibrium will be applied which is also known as the Hardy…

Q: Part C You want to test the effect of sucralose on the growth of a plant. Design a study using the…

A: The cause is the independent variable. Its value is unaffected by the other variables in your study.…

Q: Determine the gene sequence that is amplified by the use of primers in the polymerase chain…

A: The genes are a series of nucleotides found on chromosomes that code for a particular protein that…

Q: There are many types of PCR techniques available nowadays. Explain the concept of nested R and…

A: PCR stands for polymerase Chain Reaction. It is a technique which is used to amplify a given gene…

Q: Determine the appropriate bacterial strain that can be allowed to mate with the strain that is…

A: An organism's genotype is influenced by its genome as well as by its environment. It is not as…

Q: What did the miller-Urey experiment demonstrate

A: Introduction Miller-Urey experiment:- It is the experiment that suggests that organic molecules…

Q: Describe the effect of the deletion on co-transformation of pure and pepN genes that are isolated…

A: Transformation is a process of transforming the genes of one strain and then transferring it to…

Q: Which of the following would NOT be considered growth and development? A. a single cell getting…

A: All living organisms on earth from small bacteria to large dinosaurs share certain characteristics,…

Q: Which biomes are best suited for (a) raising crops and (b) grazing livestock? Use the three…

A: a) Grassland are best suited for raising crops and mainly the temperate grassland . This is so…

Q: Which species richness represents a larger island that is farther from the mainland? The red lines…

A: New immigrants to the island primarily come from the mainland. Since closer islands are simpler to…

Q: 7. How does gas exchange occur between the alveoli and capillaries?

A: Gas exchange occurs in millions of Alveoli in the lungs and surrounding capillaries which envelopes…

Q: Determine the advantages of phage therapy over antibiotict herapy.

A: Bacteriophage therapy (BT) is another name for phage therapy (PT). It treats bacterial infections…

Q: In mammals adaptive immune system T cells receptor are extra ordinary numerous diverse what function…

A: Introduction T cells are mainly of two types T helper cells and T cytotoxic cells. All the T cells…

Q: If you had nucleotide sequences from virus particles from two infected hosts, could you estimate how…

A: Introduction We can be infected by various microorganisms like bacteria, viruses, fungi. Once a…

Q: Directions: Use your basic knowledge of recombinant DNA technology to answer the question. Scenario:…

A: PCR(polymerase chain reaction) is a molecular method to make multiple copies(amplify) of a small…

Q: Linear evolution suggests that there is a ladder, or step- progression, to evolution over time one…

A: The pre-Darwinian theories established by Aristotle, when species were believed to be static…

Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…

A: DNA strand "A" = 5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…

Q: What kingdom monera

A: Introduction: Animal, plant, fungus, protist, and monera are the five kingdoms that make up the…

Q: Questions Question What is the main function of ribosomes in translation? Choose an answer Ribosomes…

A: Introduction A typical eukaryotic cell contains various cell organelles such as the nucleus,…

Q: 4. Read the following statements about various species of plants and animals. Which one would be…

A: An invasive organism which overpopulates and damages its new habitat is referred to as an invasive…

Q: Five conditions are required to maintain the Hardy–Weinberg equilibrium in a population. Closed…

A: Introduction: When a population rises Hardy-Weinberg equilibrium for the a gene, evolution ceases…

Q: Draw a trophic pyramid using the animals in the Chesapeake Bay ecosystem. Include the percentage of…

A: Food web It refers to the natural interconnection of food chains and represents what organisms…

Q: Tommy is albino and has children with Ruth who is not albino, but has an albino mother. What…

A: First question: Let the alleles of albinism be - A and a. Since albinism is inherited in recessive…

Q: 2. Identify the following structures when given images such as the ones below: ● process of…

A: Introduction The cell is the basic structural and functional unit of life present in all living…

Q: Fever can indicate that a. the pathogen remains on the skin D. the body is responding to an…

A: Normal temperature of the body is 98.6 degree fahrenheit. Fever occurs when this temperature rises.

Q: with a doubling time of 45-minutes? Use the foll

A: Given Birth size of E coli is 1 micron=10-6 water content of cell =80% Percentage of dry mass of…

Q: 4. Lipids can also be detected by a preliminary translucent spot test, also called the paper bag…

A: A translucent spot test is a qualitative assay for the determination of fats and oils. When the…

Q: 1. Why are the finds at Malapa remarkable compared to other fossil sites in Africa? dib

A: The branch of biology known as evolutionary biology examines how natural selection, common ancestor,…

Question

Please answer the following 4 questions and answer very short and briefly

What is the anticodon that would pair up with the MRNA codon UAG?
3
In What part of the cell is messenger RNA created?
Why do Transfer RNAs put their amino acids in a particular order?
What is the definition of a protein?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? Translation stalls after the initiation AUG codon is identified The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites The ribosome cannot interact with mRNAs tRNAs cannot exit the E site of the ribosome.
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands and what direction will the RNA polymerase travel to make the mRNA? Transcribe the DNA into mRNA (Include polarity)and translate the mRNA into a polypeptide chain (Include polarity)
What is the mrna codon that corresponds with binds to the anticodon of this trna molecule ccg ggc accounting ugg cgg?A bacterial is the nontranscribed region of the dna to which rna polymerase binds in order to initiate transcription?What happens during the elongation stage of dna transcription what is the function of rna polymerase?
Part of the protein-coding region in a gene has the base sequence 3- ACAGCATAACGTTC-5'. What is the sequence of the partner DNA strand? What amino acid sequence would be synthesized from the messenger RNA region?
what is the first event to take place in translation in eukaryotic cell? a. An clongation of the polypeptide chain by the addition of amino acids b. Binding of the larger ribosomal subunits to the smaller ribosomal subunits c. Base pairing of activated methionine-tRNA to AUG of messenger RNA d. The small subunits of ribosome recognizing and attaching to 5' cap of mRNA
Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. 1. How many codons are represented in this oligonucleotide? 2. If the second G were changed to a C, what would be the resulting amino acid
The following is a strand of mRNA:CAA GUG AAA ACAHow many amino acids does the mRNA strand above code for?
How does our body make protein? I This copy - mRNA - travels from the nucleus of the cell to the part of the cell known as the cytoplasm, which houses ribosomes. Ribosomes are complex machinery in the cells that are responsible for making proteins.II. The cell then expresses the protein and it, in turn, carries out its designated function in the cell on the body.III.Through a process known as transcription, an RNA copy of a DNA sequence for creating a given protein is made.IV. Then, through another process known as translation, ribosomes 'read' the mRNA, and follow the instructions, creating the protein step by step a,II-III-IV b,I-IV-II c.II, I, III, IV d,II-IV-I
What is the last codon in this mRNA sequence? AUGCCAUGG
What is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG 3’ Answer choices The signal to add a 5’ methyl-guanosine cap to the mRNA sequence recognized by the small ribosomal subunit for translation the signal to add a stretch of adenines to the mRNA Sequence that promotes transcription in eukaryotes the recognition sequence for the sigma factor of the RNA polymerase
What is the tRNA triplets codon that would fit the mRNA- 5' AUG AUC UAU GGG CCA AUU GCA UGA 3'