Q: How we can formulate a nicotine chewing gum or how we can production a nicotine chewing gum? Please…
A: Nicotine chewing gum is used by the people to stop smoking. it help to stop the habit of smoking…
Q: Which of the following is the advantage to training maximal power production with power lifts? The…
A: A learning curve is a graphical representation of how an individual learns. It typically shows how…
Q: Which of the following describes training to strengthen the neck for tactical athletes? A necessity…
A: Athletes are people who take part in physical activity in order to compete in sporting events. There…
Q: Describe at least two ways in which the contribution of mitochondrial genomes from male parents is…
A: When fathers pass their children their mitochondrial DNA (deoxyribonucleic acid), this is known as…
Q: The sequence below represents a strand of mRNA. Draw a box around the start codon. Then use the…
A: Introduction: sequence of the three nucleotides which together form a unit of the genetic code…
Q: What conclusions are there about how glucose is oxidized based on what is learned about the cellular…
A: A glucose molecule gradually decomposes into carbon dioxide and water during cellular respiration.…
Q: What abiotic and biotic consequences has fragmentation from different land-use practices had on…
A: Together with its humid-subtropical climate, Louisiana's physical geography forms the basis for a…
Q: Pure breeding red fleshed tomatoes crossed with pure breeding yellow fleshed tomatoes produced all…
A: Dominant and recessive refer to the two alleles that make up a gene. Dominant alleles are those that…
Q: 1 Sarah, a trainee of the electron microscopist at the local hospital, is reviewing some…
A: mitochondria is an essential organelle of cell that general energy by phosphorylation in form of…
Q: The following picture drawing represents co-translation in E. coli. Answer the questions: A. Which…
A: Using the signal recognition particle (SRP), the co-translational route transports secretory…
Q: Which of the following statements about glycolysis is correct? a) Glycolysis is an aerobic process…
A: All metabolic changes occur in a series of events that follow a certain pattern known as the…
Q: The antibiotic, tetracycline was serially diluted (2-fold dilutions), starting with tube #1 (100…
A: Serial dilution is a mathematical way of lowering the concentration of any solution in a gradual…
Q: FOH primary spermatocytes spermatozoa 1.7 Spermatids and spermatozoa exhibit some morphological…
A: Spermatogenesis is the process by which spermatids are transformed into spermatozoa. Spermatozoa…
Q: if the water potential of a dialysis is -4.0 and pressure potential was -2.0 and the solute is…
A: Introduction : The term "water potential" refers to the kinetic energy of water. When a solute is…
Q: The following mRNA is found inside a yeast cell: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the…
A: Given mRNA strand: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ mRNA is formed by transcription from a DNA…
Q: A 64-year-old female calls the office requesting an appointment. She tells you that recently she has…
A: A tiny electrical device is implanted during a pacemaker insertion. Most frequently, it is…
Q: duar ALLE STWOR ww ALIFOID SY 13 -88-88- 19 a DHE D THE GOD POCKE BOOK NOWN 14 PARA 98086 ... 20 CHE…
A: Introduction : The number and arrangement of all the chromosomes in the nucleus of a eukaryotic cell…
Q: Are there ways to reveal the detailedworkings of a protein machine that donot require the…
A: Proteins are dynamic biomolecules having many functions in the cell. They are the end products of…
Q: Red-green color blindness is an X-linked recessive disorder. If Allison is heterozygous (a…
A: Introduction: Color blindness is an inherited sex-linked disorder that affects the ability of…
Q: List four (4) government agencies and industry organization that can provide accurate and reliable…
A: We obtain fuel for our bodies through eating and getting enough nourishment. Every day, we must…
Q: Suppose a new mutation arises in a mitochondrial genome. Explain what would have to happen in order…
A: Mitochondria is a double membrain bound cell organelle found in eukaryotic cells. It contain double…
Q: 22. An adult mosquito has six chromosomes in each somatic cell. It mates with another adult to…
A: 22. There are two principal types of cell division- mitosis and meiosis. Mitosis is a process in…
Q: 3. The narrow sense heritability of withers height in a population of quarter horses is 17%. The…
A: The narrow sense heritability of the hand's height of a horse population was given at 17%. The…
Q: Determine the process that can be performed to distinguish the genes involved in general stress…
A: Finding the genes that are activated or inactive in response to osmolarity variations requires…
Q: A 25-year-old man comes to the physician because of a red, painful area of skin on his right leg. He…
A: Introduction An infection is defined as the invasion of tissues by pathogens, their growth, and the…
Q: Which of the following statements are correct about tumors and metastasis (select all that apply)?…
A: Tumor is an abnormal mass of cells which grow and divide more than their requirement or they do not…
Q: All signaling molecules bind to receptors on the cell surface. Select an answer and submit. For…
A: Ligand molecules are signalling molecules that basically interact with another molecules and…
Q: A male patient calls the office complaining of bloody urine accompanied by edema, headache, and…
A: Patients with contrast-induced nephropathy—defined as acute renal failure—present with an increased…
Q: In 1988, neurologists in Australia reported the existence of identical twins who had developed…
A: Myoclonic epilepsy is a type of epilepsy that is characterized by myoclonic seizures. Myoclonic…
Q: What was the initial pH of the milk? 07 4 11 2
A: As the milk ages , fermentation done by lactic acid bacteria accumulates lactic acid which makes the…
Q: 2) Answer the following questions about an experimental preparation where you have cut all nerves…
A: Frog's heart Contains three chambers and no division between oxygenated and deoxygenated blood. It…
Q: Which of the following are important variables that determine the equilibrium number of species in…
A: The theory of island biogeography states that the equilibrium in number of species is determined by…
Q: Which is a structural gene? A. The gene that encodes ß-galactoside permease OB. Allolactose OC. The…
A: Operon is the gene regulatory mechanism in prokaryotes that regulates many genes that are involved…
Q: How do you know if the halibut you purchased at the supermarket is really halibut? To identify the…
A: Introduction The final complex of mitochondrial eukaryotic oxidative phosphorylation is called…
Q: Question: The vast majority of calico and tortoiseshell cats are female, however occasionally a male…
A: Yes, the majority of tortoiseshell cats are female. This is because the gene that determines the…
Q: How many different DNA sequences could code for amino acid sequence Met-His-Leu-Thr-Trp-Lys? (Note:…
A: DNA is a hereditary molecule. It carries the genetic information that is passed from one generation…
Q: Homo habilus can be characterized as____. a. more robust than P. boisei b. somewhat similar to Au.…
A: The Latin word homo means "man" or "human." To emphasize how closely related this species is to our…
Q: Alex is an active senior in high school who arrives for his appointment at 3:30 p.m. to see the…
A: Herpesvirus is a virus that causes infections in humans. These viruses are typically spread through…
Q: What does the medial corticospinal tract control? A. Bilateral movements of the trunk of the body B.…
A: The anterior corticospinal tract sends fibers mainly to the trunk or axial muscles.
Q: This diagram shows an animal cell in meiosis I during crossing over and synapsis. A single tetrad is…
A: Meiotic division includes Meiosis I and Meiosis II, which are necessary for the production of…
Q: Calculate the number of Alu elements present in the haploid human genome based on the number of Alu…
A: Introduction : The haploid human genome contains approximately 3 billion base pairs of DNA i.e…
Q: Normally when a person consumes a product that contains lactose (such as milk or cheese), the body…
A: Galactose to glucose conversion in the body is hampered by galactosemia, a rare, inherited condition…
Q: Increase of ATP concentration Dephcsphorylation of glycogen phosphorylase Increase of glucose-6-…
A: Glycogen synthesis Glycogen synthesis , also called glycogenesis is the process by which the liver…
Q: Vertebrate phylogenetic tree St. bony fish amphibians mammals turtles lizards snakes crocodiles…
A: sister taxa are pairs of terminal taxa branch from a common node and are often closely related…
Q: 1. What are the new DNA sequences and the corresponding new amino acid sequences of these two…
A: Any change in the DNA sequence is known as mutation. Usually two types of mutations are found that…
Q: The activity of cyclin dependent kinases is regulated by: A Their concentration inside the cell B с…
A: Cyclin dependent kinases (CDKs) are a family of proteins that act as molecular switches to control…
Q: What happens during the regeneration stage of the Calvin Cycle? Energy from ATP and electrons from…
A: The stroma of chloroplasts in a plant cell undergo a sequence of processes known as the Calvin…
Q: 1. Describe which of the sampling techniques pictured above provides the best quantitative method…
A: Planktons are microscopic organisms that float freely in bodies of water such as freshwater lakes,…
Q: What are dietary supplements and in what situations are they "good" for you? In what situations are…
A: "Malnutrition, also known as malnourishment, is a situation caused by eating a diet that contains…
Q: Provide a explantion and diagram of the Intracellular mechanism of smooth muscle relaxation via…
A: Introduction: Our body have different kinds of nervous system such as central nervous system…
Step by step
Solved in 2 steps
- Why are smears of capsulated bacteria not heat-fixed before staining as opposed to Gram staining?What is the function of the mordant used in the Gram staining procedure? If the iodine step is skipped, what color are Gram-negative cells observedwhat is the function of each one of the Gram-stain reagents?
- What is the purpose of the alcohol (OH) in the gram staining process? Explain.What is the correct Gram reaction of the unknown bacterium growing on your MacConkey agar (Gram (+) or Gram (-))?Is the Triple-Sugar Iron Agar (TSIA) a complex or defined medium? Explain based on its composition. Is the test tube a A) broth, B) slant, or C) deep agar medium? Why is a “needle” used to inoculate?
- What would be the result of the gram stain if acid alcohol is used as a decolorizer rather than the gram decolorizer?what effect would failing to drain the smear in-between staining have on your judgment of the gram reaction of an organism?Does agar concentration affect the growth and morphology of bacterial colonies? What causes dense growth and what causes minimal growth?
- What are the possible reasons why culture plates may have too many colonies despite performing serial dilutions and OD600 readings?What is the purpose of iodine in the gram staining process? Explain.How would you expect the staining properties of 24-hour culture of Bacillus subtilis or the other Gram-positive bacteria to compare to culture that is 3 to 4 days older?