Q: Please help explain Angiotensin-converting enzyme 2 (ACE2) is a receptor for cell entry of…
A: Angiotensin II converting enzyme has the main role of degradation of Angiotensin II. It is the main…
Q: Question - Summarize the goals of conservation biology .
A: Conservation biology- It is an applied science based on ecological principles. it focuses on…
Q: ACP is specific of the pancreatitis O True O False is defect inglucuronyl transferase O Gilbert…
A: Acute pancreatitis is a pancreatic inflammatory illness that can occur all at once or in relapses.…
Q: Which of the following would apply to desmosomes that are found in cells as they migrate from the…
A: The stratum corneum is the outermost layer of the epidermis and it marks the final stage of the…
Q: Can you explain which answer is accurate and why it's the correct choice?
A: The bottleneck effect describes how a population's size is reduced and then increased, affecting the…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: If your 16x concentrated stock solution contains 20g of Nacl per liter, how much NaCI would one…
A:
Q: To summarize: The concept of energy flow through a food web.
A: The Sun provides energy to the Earth in the form of light. The organisms efficiently exploit the…
Q: If the molecular weight of E.coli DNA is taken as 2.7x10 and the average molecular weight of any…
A: Note: The Values given in the question may be different as in original question, but concept is…
Q: 1. A package of nuts contains 3 servings, and each serving contains 150 calories. If you eat the…
A: A calorie is a unit of energy. It refers to the energy people get from food and drink they consume.
Q: What would happen if you forgot to add NaCl in culture used for isolating vibrios? Which species…
A: Vibrio bacteria are comma shaped(Curved rod shaped)bacteria; which shows mobility because of the…
Q: 10. Phagocytosis by a phagocyte is required for: a. B cell action d. all of the above b. helper T…
A: B cells usually bind to specific soluble antigenic peptides. It happens through the B ce receptor.…
Q: If a plant’s stomata are made to stay open at all times, orclosed at all times, it will die. Why?
A: Stomata are the tiny holes which are present on the surface of the leaves. The function of the…
Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…
A: INTRODUCTION Protein synthesis is the process in which the formation of new proteins takes place. In…
Q: European cuckoos and North American brown-headed cowbirds are not close relatives, but both lay…
A: Animal behavior is heavily influenced by the environment to which it belongs. If they do not fit in,…
Q: You measure the effects of a single allele (Y) on fitness in two populations of spiders, Population…
A: Introduction The incidence of a gene variant in a population is represented by the allele frequency.…
Q: Will the plate and breed count of the same milk approximate each other? Why or why not?
A: A Plate count method is used for identifying the number of cells which are actively growing in a…
Q: 9. Coronary arteries route oxygen rich blood into the tissues of the heart. They branch off of the:…
A: Coronory arteries are arteries supplying oxygen rich blood to the heart muscle.There are two main…
Q: i INSERTED make an insertion mutation by inserting a C after the 4th codon. Click show protein. Ø…
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: Why are new drugs for heptacellular carcinoma necessary? Highlight: - that the risk factors for…
A: Hepatocellular carcinoma or the liver cancer can be treated by several drugs. Moreover, every cancer…
Q: Describe the proximity in time, similarity in timbre, pitch and good continuation? How are these…
A: Sound is defined as the vibrations that travel through the air or another type of medium as an…
Q: MECHANISMS EXAMPLES 1. 1. Geographical Isolation 1. 2. 2. Temporal/Seasonal Isolation 3 | 1. 2. 3.…
A: Ecological, temporal, behavioral, mechanical/chemical, and geographical isolation techniques all…
Q: 5. Which of the following can increase mean arterial pressure (MAP) in an individual? I. II. III.…
A: Given : Mean arterial pressure (MAP) is defined as the average arterial pressure that happens…
Q: how an angiotensin converting enzyme inhibitor ACE such as captopril would effective as an…
A: Anti hypertensive means the drug causes the reduction in blood pressure. Normal blood pressure is…
Q: in certain fish the mating of black-scaled (B) with white a white-scaled (W) will create offspring…
A: Introduction :- Fish are aquatic vertebrate animals having gills but no digits on their limbs, such…
Q: Give the common characteristics of animals that falls under the category of Family: Felidae in…
A: INTRODUCTION Felidae is a clade of mammals belonging to the order Carnivora and is commonly referred…
Q: f your 16x concentrated stock solution contains 20g of Nacl per liter, how much Nacl would one liter…
A: Given:- Concentration of stock solution= 16X NaCl required per litre= 20g NaCl required for 1 litre…
Q: Could you perform the Ames test with a strain of bacteria that was auxotrophic for something other…
A: Ames test is a test used for the determination of the mutagenicity of a chemical compound. It was…
Q: C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' i. What would be the first 5 bases at the 3' end of the…
A: 3' C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' Complementary strand- 5'- CTCAATTCCGAGGATCCAAT-3' i)…
Q: Many fungi are decomposers and degrade organic matter (such as wood and leaf litter). It has become…
A: Fungi are one of the most important organisms on the planet, they act as decomposers of organic…
Q: 6. Which of the following statements best explains why cancer is so difficult to cure? O A. Each…
A: Cancer is a condition in which some cells in the body grow out of control and spread to other parts…
Q: Describe how ecology affects evolution. Provide an example in which the ecological interaction…
A: Ecology is the inter relationship between the biotic community and abiotic environment. Because it…
Q: Describe how biodiversity contributes to the sustainability of an ecosystem.
A: Biodiversity refers to the variety of life that may be found in a given flora and fauna and even…
Q: The mating below shows the sex chromosome found in two parents and their resulting offspring. FMR1…
A: Introduction An organism's genotype is its entire set of genetic material. The alleles or variants…
Q: The O-antigen is part of the bacterium's which is found in the outer membrane of some bacterial cell…
A: O-antigen plays a very important role in microbes and host interaction. It is generally present in…
Q: Stem cells can give rise to many different types of cells. How could stem cells most likely be used…
A: As stem cells are the cells which have the ability to divide and can give rise to many different…
Q: Describe how biodiversity contributes to the sustainability of an ecosystem.
A: Biodiversity improves human health and offers employment in agriculture, fishing, forestry, and many…
Q: 1. Along the coast of Vancouver Island in British Columbia, Canada consists of intertidal zones…
A: Introduction The term "population" usually refers to the number of people living in a specific…
Q: To determine: The trophic levels and the way in which they are related to ecological pyramids.
A: The Sun provides energy to the Earth in the form of light. The organisms efficiently exploit the…
Q: 8. Which of the following statements about oxytocin is correct? A. Dilation of cervix and baby…
A: Oxytocin is a hormone delivered by the pituitary organ that causes expanded expansion of the uterus…
Q: 1. Summarize the blood level data with a frequency distribution. 2. Calculate the arithmetic mean.…
A: There are few important points to remember : Mean : It is defined as sum by number of its value .…
Q: Examine the family pedigree. What is the probability that their next child will have dry air wax?…
A: Pedigree Pedigree is a chart or diagram that show the occurrence and appearance of any gene of…
Q: PRIMAL PICTURES 1. Name the nervous system receptor labeled A 2. Name the specific structure labeled…
A: The given image shows the anatomy of the skin. Anatomy of skin: The anatomy of skin reveals that…
Q: Which of the following does NOT play a role in DNA replication? O helicase promoter O ligase…
A: ANSWER;- None of the above Explain;- Does not play a role in DNA replication is a stop codon. -Stop…
Q: DNA DNA Leading strand mRNA tRNA Amino Acid A T G A A A G T C A T…
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: Question 30 a co-immunoprecipitation experiment is shown comparing cancer and non- cancer cells,…
A: 30... Western blot Western blot work on enzyme-linked immunosorbent assay principle, The Western…
Q: A survey on the trait: Free and Attached earlobes.The allele for free-hanging earlobes is F.while…
A: We have, Total number of students - 600 Number of students with attached earlobe (recessive) - 278…
Q: Please discuss the value of international normalized ratio (INR) as a test. Why do you think this is…
A: PT test is the normal blood test conducted to record the time taken for blood to clot.
Q: 3. Estimate the flow resistance in a small arteriole (lumen diameter 25 microns; length 0.1 cm) for…
A: Introduction The proportion of red blood cells in your blood is measured by a hematocrit test. Your…
Q: Provide an illustration and describe the different types of egg as to the concentration of yolk they…
A: Isolecithal eggs : It is a type of holoblastic egg.. In this type yolk distribution is same that is…
What is the difference between endergonic and
exergonic
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
