Please help with complete solution asap What is the function of the seven phenylalanine codons in the 15-amino-acid leader peptide shownbelow in the regulation of the E. coli phe operon?phe operonMet - Lys - His - lle - Pro - Phe- Phe-Phe - Ala - Phe - Phe - Phe - Thr - Phe - Pro - Stop5' AUG - AAA - CÁC - AUA - CCG - UUU - UUU - UUC - GCA - UUC - UUU - UUU - ACC - UUC - CCC - UGA 3'Could the transcriptional attenuation mechanism found in the amino acid biosynthetic operons regulategene expression in eukaryotic cells? Briefly explain your reasoning.

Transcriptional attenuation is a process where an attenuator in the operon causes the formation of…

What is the function of the seven phenylalanine codons in the 15-amino-acid leader peptide shown below in the regulation of the E. coli phe operon? phe operon Met - Lys - His - Ile - Pro - Phe- Phe-Phe - Ala - Phe - Phe - Phe - Thr - Phe - Pro - Stop 5' AUG - AAA - CAC - AUA - CCG - UUU - UU - UUC - GCA - UUC - UUU - UUU - ACC - UUC - CcC - UGA 3'

What is the function of the seven phenylalanine codons in the 15-amino-acid leader peptide shown below in the regulation of the E. coli phe operon? phe operon Met - Lys - His - Ile - Pro - Phe- Phe-Phe - Ala - Phe - Phe - Phe - Thr - Phe - Pro - Stop 5' AUG - AAA - CAC - AUA - CCG - UUU - UU - UUC - GCA - UUC - UUU - UUU - ACC - UUC - CcC - UGA 3'

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 11TYU

See similar textbooks

Similar questions

When tryptophan levels are high in E. coli, what conformation does the trp leader mRNA adoptand what is the effect on transcription of the rest of the trp operon?a) conformation 2, transcription continuesb) conformation 1, transcription continuesc) conformation 1, transcription stopsd) conformation 2, transcription stops
Which of the following lac operon genotypes would allow for functional versions of all the structural enzymes of the lac operon to be expressed constitutively even in the absence of lactose? Group of answer choices I+ O+ Z+ Y+ A+ I- O+ Z- Y- A- I+ OC Z+ Y+ A+ IS O+ Z+ Y+ A+ I+ O+ Z- Y+ A+
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
Which of the following is true about the Lac operon? Group of answer choices An operon with a constitutive operator (O^C mutation) will transcribe in the presence of a super repressor It is a positive repressible operon that is influenced mainly by fluctuations in glucose levels Produces a large quantity of tryptophan in order to synthesize lactase It is found in eukaryotes and is responsible for creating an enzyme that breaks down lactose
How will transcription of the E. coli trp operon be affected by the following manipulations of the leader region of the trp mRNA? - Changing several nucleotides in region 3 so that in can base pair with region 4 but not with region 2 - Removing region 4 - Increasing the distance between region 2 and region 3 - Increasing the distance (number of bases) between the leader peptide gene and region 2
What are the effects of the following conditions on Lac operon of bacteria? Do not forget to mention about the role of repressor, activator, RNA polymerase in each case! A) Glucose is absent and lactose is present B) Glucose is present and lactose is present C) Glucose is present and lactose is absent
How would each manipulation of the leader region of the trp mRNA affect transcription of the E. coli trp operon? 1. Increasing the distance (number of bases) between the leader peptide gene and sequence 2 would ___________________ transcriptional attenuation of the trp operon. (increase/decrease/not change) 2. Increasing the distance between sequences 2 and 3 would ____________________ transcriptional attenuation of the trp operon. (increase/decrease/not change) 3. Removing sequence 4 would ________________ transcriptional attenuation of the trp operon. (cause/not change/prevent) 4. Changing the two Trp codons in the leader peptide gene to His codons would cause transcriptional attenuation of the trp operon to ____________________. (lose its sensitivity to histidine/increase its sensitivity to tryptophan/lose its sensitivity to tryptophan) 5. Eliminating the ribosome‑binding site for the gene that encodes the leader peptide would cause transcriptional attenuation of the trp operon to…
What is a specific region in the trp operon that you could mutate so it expresses the trp operon in conditions of excess tryptophan. Why will this mutation cause this? Operon structure: promoter, operater, structural genes promoter - DNA region that is the site of RNA polymerase sigma binding and transcription initiation operator – DNA region that influences gene expression through its interaction with a protein (transcription factor) structural genes – gene whose expression is being regulated; encodes a polypeptide or functional RNA
The transcription of many bacterial genes relies on functional groups called operons, such as the tryptophan operon. What is an operon?
In a bacterial cell with the genotype I-: P+: O+: Z+: Y+: A+, which of the following expression patterns of the lac operon would you see? (All + signs designate functional units and - signs designate non-functional units) A. No expression of Z, Y and A under any environmental conditions. B. Z, Y and A would always be expressed. C. Z, Y and A would be expressed when lactose was present but not expressed if lactose is not present. D. Z, Y and A would be expressed in the absence of lactose, but not when lactose was present. E. None of the above.
A haploid E. coli cell has the genotype I ¯ P+ O+ Z+ Y ¯ where the I ¯ indicates that the repressor protein cannot bind to the operator due to a mutation. Which of the following statements about cells with this lac operon genotype are correct? I ¯ P+ O+ Z+ Y ¯ Select all that apply. β-galactosidase will be transcribed constitutively. The cells are able to import lactose across the cell membrane. The cells are lac+ and are able to grow on a medium with lactose but no glucose. RNA polymerase can bind to the promoter.
Describe operons in your own words, as if you were explaining what an operon is to someone who knew about DNA and cells etc but did not know what an operon was. Here are some things you can discuss: Are operons controlling transcription or translation? Which organisms are they found in? What do the genes in an operon have in common with each other?