Q: To determine: The causes of nitrogen deficiency in plants.
A: One of the major causes of poor yields in plant crops is nitrogen shortage. Nitrogen is a critical…
Q: Refer to Figure 18. Are the storage roots of sweet potato ( Ipomoea batatas) and the tubers of…
A: HOMOLOGOUS ORGANS The study of morphological characteristics like origin, development, and position…
Q: How do populations (or strains) of microbes evolve resistance to antimicrobials? (For this question,…
A: Introduction Antibiotics are antibiotics that are used to treat bacterial infections in humans and…
Q: Pertaining to the side of the body lateral Lying on the belly Lying on the back
A: Ans : the correct answer for the following question. Lying on the belly - PRONE Lying on the back -…
Q: What is structural variation of genomes? Describe the mechanisms that create structural variants,…
A: Structural variations are referred to variation or difference in the structure of chromosome of…
Q: 6. Draw changes in potential in the wet bone during cyclic compression. 7. Can the flow potential be…
A: There are few important points that should be kept in mind : As we know that bone tissue consist of…
Q: Why is electrophoresis important in Molecular Biology
A: The elctrophoresis is a general term that depicts the migration and partition of charged particles…
Q: __________ are composed of a single linear (unbranching) chain of covalently bound amino acids.…
A: Amino acids are known as the building blocks of protein. These are organic compounds mainly composed…
Q: TrueorFalse Monosaccharides have to be broken down many times during digestion
A: Carbohydrates are biological macromolecules composed of carbon, hydrogen, and oxygen. It is a…
Q: To explain: The difference between sexual and asexual reproduction and describe the advantages of…
A: Reproduction is the biological process of producing offspring for their parents. It is an essential…
Q: What are differences in which CMV & the ssRNA bacteriophages protect their genomes within the host…
A: To explain: To explain the differences in which cucumber mosaic virus and the ssRNA bacteriophages…
Q: 5. How might exposure to a more acidic pH affect the growth, development and reproduction of sea…
A: Sea urchins come under the category of keystone species, indicating their abundance has a direct…
Q: Which of the following post-translational modification(s) anchor(s) the protein to the biological…
A: By covalently adding functional groups or proteins, proteolytic fragmentation of regulatory…
Q: What are tyrosine kinase and GPCR? Give example of one pathology that can occur in…
A: Tyrosine kinase and GPCR dysregulation and rescue :-
Q: What is endocrine regulations? What does growth hormone do in adults? What is male reproductive…
A: Endocrine gland is a gland which liberate their secretion that do not crosses through special ducts…
Q: How are biogeochemical cycles interconnected
A: Introduction :- A biogeochemical cycle (or, more broadly, a matter cycle) is the process through…
Q: Coffee (Coffea arabica) and Chocolate (Theobroma cacao) are two species of tropical or sub-tropical…
A: Importance of coffee-Optimal coffee-growing conditions include cool to warm tropical climates, rich…
Q: State the primary function of the respiratory system. Name functions of the skin (give 3)_ Name the…
A: State the primary function of the respiratory system. This system assists the body in absorbing…
Q: A. A mutation is recovered in the gene that encodes the lactose operon repressor protein (LacI).…
A: Lac operon is a simple prokaryotic group of genes for the metabolism of lactose. It consists of…
Q: How many external membranes are present in a land plant chloroplast?
A: Chloroplast membranes consist of about 45% protein and 55% lipid. It is an organelle mainly…
Q: Give the meanings for the following conditions: 11. hyponatremia - 12. polydipsia - 13. glycosuria -…
A: Medical biology is a branch of medicine which use laboratory methods (analysis, microscopy,…
Q: Please solve and answer in complete sentences. (thank you) Sequence divergence vs conservation for…
A: The exons are the type of sequences that are utilized after the processing of the mRNA is complete.…
Q: Which group bears stomata only in the sporophyte generation? Answer A. Bryophyta B.…
A: Stomata These are defined as the cell structures that are present in the epidermis of leaves and…
Q: Describe the hindlimb function / specialization for a rabbit, pigeon, turtle, and toad.
A: Introduction:- The bones of the hind limb include the femur, the meniscus ligament, the ankle and…
Q: Which is better, using a combination of pest management control techniques or using only one type of…
A:
Q: The first juvenile larva of Ascaris is known as- (A) Filiform larva (B) Rhabditiform larva (C)…
A: Ascaris is commonly known as roundworm. It belongs to phylum nematoda.
Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…
A: To find: To find the complementary base sequence and the corresponding mRNA sequence using the given…
Q: 6. You were asked by your laboratory instructor to prepare the following: 12 plates (use maximum…
A: The nutrient media contains essential nutrients to support the growth of microorganisms. Different…
Q: . Why doesn't having a gene variant associated with a particular illness or disorder guarantee a…
A: Genes are DNA structures found in chromosomes. The structure of our genes governs how our bodies…
Q: Olfaction Taste Hearing Vision Bony Fishes Frog (Amphibians) Crocodile (Reptiles) Chicken (Aves)…
A: The mammals belongs to the class Mammalia. They are any member of the group of vertebrate animals in…
Q: How does the evolution of endodermis, lignified cell walls, sclerenchyma, vascular tissues, true…
A: Vascular plants are those plants it causes vascular tissues for the transfer of substances. Vascular…
Q: In gram staining, could colors other than red be used as a counterstain?
A: A counterstain is a stain with color contrasting to the principle stain, making the stained…
Q: Explain the reason why the roots lack the protective covering like the plant surface which has a…
A: Roots are the parts of vascular plants that are normally found below ground. During seed…
Q: What is the name of the mechanism that ensures that there is a higher concen- tration of sodium ions…
A: To identify: To identify the name of the mechanism that ensures that there is a higher concentration…
Q: Lying on the belly Lying on the back State the three main functions of the digestive system.
A: Introduction Digestive system:- It breaks down food into nutrients such as carbohydrates, fats, and…
Q: Although several different mammalian species have been cloned, the efficiency of this process is…
A: DNA methylation is a process in which a methyl group attaches to the promoter site severely…
Q: MEDICAL TERM|MAIN ENTRY (pronunciation)|MEANING (definition) 1. astigmatism 2. blepharitis 3.…
A: Astigmatism is a condition of the eye in which the front surface of the eyes (cornea) of the lens or…
Q: Selina was taken to the emergency room after being so weak and confused. She has been suffering from…
A: Normal blood pH is 7.35. When somehow this pH increases beyond this normal level it results into…
Q: Which is true regarding Herpesviridae? Select all that apply. ( Measles in an example O HSV-1 is an…
A: Herpesviridae is a large family of DNA viruses. It includes HSV1 and HSV2.
Q: 7. The half-life of a hormone in blood can be enhanced by I. binding to plasma proteins II. binding…
A: A hormone's half-life and duration of activity are restricted and vary from hormone to hormone. The…
Q: Explain the importance of describing the morphological characteristics of bacterial colonies when…
A: Introduction A bacterial colony is a cluster of bacteria that all came from the same mother cell.…
Q: Summarize the basic features of excavates and distinguish among diplomonads, parabasilids, and…
A: Protists are unicellular eukaryotic organisms.
Q: The small opening in the integument(s) of the angiosperm egg sac through which the pollen tube…
A: Answer is e. The micropyle
Q: What are the primary limitations imposed by using Hanging-drop method (or Wet mount) to observe…
A: Hanging drop preparation is a type of wet mount in which a drop of organism-containing media is…
Q: ORIGIN 1 acacttgctt ctgacacaac cgtgttcact agcaactaca caaacagaca ccatgctgac 61 tgctgaggag aaggctgccg…
A: The gene contains information to code for specific proteins in the form of the nucleotide sequence.…
Q: 1. What are the different lenses on the microscope? 2. What lens should be down (closet to the…
A: Introduction Microscope: It is a laboratory optical instrument that is used to examine an object…
Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…
Q: What are the importance of molluscs to other organisms, environment, medicine, etc.?
A: Introduction Mollusca is the second-largest phylum of invertebrate organisms after Arthropoda, with…
Q: What I Have Learned Direction: With the use of Venn Diagram, compare and contrast the plant and…
A: Introduction:- The process of having children is referred to as reproduction. Sexual and asexual…
Q: What is the mechanism for lymphocyte maturation so that lymphocytes will respond to non-self cells…
A: Introduction:- White blood cells, or lymphocytes, are one of the body's main types of immune cells.…
What is the gene that goes with a trait called
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Based on MS- LS3-1 Can you make a model that shows how blue eyes originated? Can you include genes, chromosomes, traits, proteins, and organisms? Can you Include a Punnett Square to show how this trait could be passed on to the next generation?Genetics Question: In humans, an allele for black hair in one gene can mask the expression of color on a secondgene. In one family with 10 children, 7 have black hair like their parents, 2 with red hair, and onewith blond hair. The blond child soon came of age and married a man with red hair. All their children have red hair. a. What specific mode of inheritance is exhibited? b. Using the letters A and B, assign alleles to the traits c. Based on the 9:3:3:1 ratio, what are the genotypes of the following: 7 children with black hair ________________ 2 children with red hair ___________________ 1 child with blond hair ____________________ d. Give the COMPLETE genotypes of the following: Parents of the children ____________________ Man with red hair _________________________ All children (of the man) with red hair ________________1. In humans, widow’s peak (W) is dominant over having a straight hairline (w). If a homozygous man with a widow’s peak has a child with a woman with a straight hairline, what are the odds the child will have a widow’s peak? Show work. 2. Ellis-van Creveld syndrome is a recessive inherited condition that results in 6-fingered dwarfism. Two parents without this condition have with Ellis-van Creveld syndrome. What are the genotypes of the parents and offspring? What are the odds that the son will have a 6-fingered child if his partner is a woman who is heterozygous for the condition? Show work. 3. The gene for dangling earlobes is dominant over the gene for attached earlobes. A woman with attached earlobes has a child with a man with dangling earlobes whose mother had attached earlobes. What is the probability that this child will have attached lobes? Show work. 4. In humans, normal pigmentation is due to a dominant gene, while albinism is recessive. A normally pigmented man has a…
- Researchers in search of loci in the human genome that arelikely to contribute to the constellation of factors leading tohypertension have compared candidate loci in humans and rats[Stoll, M., et al. (2000). New Target Regions for Human Hypertensionvia Comparative Genomics. Genome Res. 10:473–482].Through this research, they identified 26 chromosomal regionsthat they consider likely to contain hypertension genes. Howcan comparative genomics aid in the identification of genesresponsible for such a complex human disease? The researchersstate that comparisons of rat and human candidate loci tothose in the mouse may help validate their studies. Why mightthis be so?In this video https://www.youtube.com/watch?v=PXPIu8LazqI 1. Of all the latest innovations mentioned, why direct-to-consumer genetic testing is the most useful specially in our "New Normal" setup? How it can be helpful?Written Response 1a) Identify the genotypes of individuals ii-1, ii-4, iii-4, and IV-1. b) If individual III-9 and individual III-10 have another child, what is the probability that this child will have normal colour vision? Sketch a punnett square to support your answer (be creative -- you can type this up on the computer) c) Determine the frequency of the achromatopsia allele in the population illustrated in the pedigree. Round your answer to three decimal places. Show your work.
- Answer the following MCQs: 1:This database is most likely to have data about gene expression. GenBank BLAST dbEST RefSeq PDB 2: Dot matris noise reduction: window size is 7 by 7 and mismatch is 2. What is the minimal number of matches in this window that allows us to place the dot? 2 3 1 5 4 3: Find the optimal global alignment of two DNA sequences _ACAAC and AC. Match = 2, mismatch =0, gap opening =-3, gap extention=-1. What is the total score of alignment? 2 -1 0 -3 1Question:- Based on your selected mode of inheritance, show the genotypes for the following individuals. [Use these symbols for alleles: if it is autosomal, then use the symbols B - dominant, b - recessive (e.g. BB, bb etc.) if it is X-Linked, then X(B) - dominant, X(b) - recessive, and Y for Y-chromosome (e.g. X(B)X(B), X(B)Y etc.) ] I-1 I-2 II-7 II-8 III-10 III-11 III-12 IV-8 IV-9Variations in Phenotype Expression A genetic disorder characterized by falling asleep in genetics lectures is known to be 20% penetrant. All 90 students in a genetics class are homozygous for this gene. Theoretically, how many of the 90 students will fall asleep during the next lecture?
- Based on Standard NGSS MS-LS3-2: Develop and use a model to describe why asexual reproduction results in offspring with identical genetic information and sexual reproduction results in offspring with genetic variation. In reference to the attached image, can you create a model that shows how it is possible that the twins ended up with such different traits yet have the same parents? Keeping in mind that the twins are a set of fraternal twins. Note:Required a cause-and-effect relationship between parents and offspring with the appropriate mechanism, and Diagram shows genetic recombination as well as inheritance31. Use a Chi-squared test on the F2 generation data to analyze your prediction of the parental genotypes. Show all yourwork and explain the importance of your final answer. (4)32. Determine the genotypes of the original parents (P generation) and explain your reasoning. You may use Punnettsquares to enhance your description, but the results from the Punnett squares must be discussed in your answer. (4)33. The brown-eyed female in the F1 generation resulted from a mutational change. Explain what a mutation is, anddiscuss two types of mutations that might have produced the brown-eyed female in the F1 generation. (4)Corn and Mendelian Genetics Red Smooth Red Wrinkled Yellow smooth yellowwrinkled #Expected 25 25 25 25 #observed 29.6 53.4 7.2 9.8 X2 value 0.85 32.26 12.67 9.24 The data above is from genetic tracking two traits inherited in Corn. Use the X2 values provided to find the sum of the X2 for this stimulation. Round your answer to the nearest tenth. Mendelian genetics (Probability value and degree of freedom) Red Smooth. Red Wrinkled. Yellow smooth yellowwrinkled #Expected. 25 25 25 25 #observed. 29.6 53.4 7.2 9.8 X2 value. 0.85 32.26 12.67 9.24 The data above is from genetic tracking two traits inherited in Corn. Based on the data above , you can see that the difference between the expected and predicted outcomes is -- (a) significant or (b) not significant? the predicted is…