What is the name of the enzyme, shown as the yellow blob circled in red, that opens the helix and adds RNA nucleotides to make the strand of RNA? O DNA Polymerase O Helicase ORNA Polymerase O Lactase 4 6. 8 9 10 Nex

What is the name of the enzyme, shown as the yellow blob circled in red, that opens the helix and adds RNA nucleotides to make the strand of RNA? O DNA Polymerase O Helicase ORNA Polymerase O Lactase 4 6. 8 9 10 Nex

Name: What is the name of the enzyme, shown as the yellow blob circled in r
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What is the name of the enzyme, shown as the yellow blob circled in red, that opens the helix and adds RNA nucleotides to make the strand of RNA?O DNA PolymeraseHelicaseRNA PolymeraseO Lactase89 10Nex24M9

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 18RQ: During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol...

See similar textbooks

Similar questions

What is the function of DNA polymerase? a. It degrades DNA in cells. b. It adds RNA nucleotides to a new strand. c. It coils DNA around histones to form chromosomes. d. It adds DNA nucleotides to a replicating strand. e. None of these.
Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
Match the terms appropriately. ___ nucleotide ___ clone a. nitrogen-containing base, sugar, phosphate groups ___ autosome b. copy of an organism ___ DNA polymerase c. does not determine sex ___ mutation d. injects DNA ___ bacteriophage e. replication enzyme ___ semiconservative replication f. can cause cancer g. something old, something new ___ DNA ligase h. seals gaps and breaks
During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’
How many subunits does E. Coli DNA polymerase I have? 5 10 1 3
2. Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an mRNA and tRNA that can produced that proteina. mRNA strandb. tRNA strandc. DNA strand (5’-3’)d. DNA strand (3’-5’)
Enzymes that catalyze DNA denaturation or melting are: gyrases topoisomerases helicases DNA pol I
Which enzyme catalyzes the elongation of a DNA strand in the 5' to 3' direction? Group of answer choices DNA ligase primase DNA polymerase I DNA polymerase III
During DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer and the first incoming deoxyribonucleotide for an Okazaki fragment on the lagging strand? topoisomerase DNA polymerase III DNA helicase DNA polymerase II DNA ligase
DNA strand 1 (template) TACATGCTCGTGACTTTT Mutation in strand 1 TACATGTCGTGACTTTT DNA Strand 5 (template) TACAGGTGTTCCCAGATCGGG Mutation in DNA strand 5 TACAGGTGTTCCCATATCGGG 1.use the original (template) strand of DNA to find the correct amino acid sequence in the DNA. 2.find and highlight the mutation in the DNA. 3.Find the new sequence of the amino acids for the protein in the new mutated strand of DNA. 4.Determine if this mutation is a point mutation of a Frame shift Mutation. 5.Determine if it is a silent mutations, Missense mutation, Nonsense mutation, Insertion or Deletion. 6.will this new protein function the same as the old protein? Why or why not?