Answered: When the skin is exposed to sunlight it…

Science

Biology

When the skin is exposed to sunlight it will produce: Calcium Vitamin D Vitamin C Vitamin D precursors X

An Illustrated Guide To Vet Med Term

4th Edition

ISBN:9781305465763

Author:ROMICH

Publisher:ROMICH

Chapter13: Nerves Of Steel

Section: Chapter Questions

Problem 2SC

See similar textbooks

Related questions

Q: When the skin is exposed to sunlight it will produce: Calcium Vitamin D Vitamin C Vitamin D…

A: There is a two sources of vitamin D in our body. One is dietary intake and other is our skin.…

Q: Describe significant changes in the musculoskeletal system with aging.

A: Introduction The aging of cells can be attributed to several factors such as degradation of cellular…

Q: Why are there three layers of stomach muscle and how do they function?

A: The stomach is J shaped organ that is present in the upper abdomen on the left side of the body. The…

Q: How does osmotic diarrhea differ from secretory diarrhea?

A: Diarrhea is a condition in which the frequency of stool increases along with increase in its…

Q: Based on our current knowledge of biology on Earth, above what temperature (in °C) would biological…

A: The survival of the living organisms is dependent on various factors in which temperature is one of…

Q: What has been successful in previous attempts for weight loss?

A: Being overweight has an adverse impact on the health of a person as it can invite various diseases…

Q: d loss during childbirth can result in an inadequate amount of blood volume in the mother's body.…

A: Menstrual cycle starts at the time of puberty of a female. There are tremendous hormonal changes…

Q: Z Primate Opposable Thumb? Length of Thumb (cm) Claws or Nails?

A: A primate is any mammal of the group that includes lemurs, lorises, tarsiers, monkeys, apes, and…

Q: 3. Explain why the specimen must be centered in the field of view on low power before going to high…

A: Microscopy is the technical field of using microscopes to view objects and areas of objects that the…

Q: Estimate the overall efficiency of photosynthesis and describe where in the pathway energy is…

A: With the aid of chlorophyll and sunshine, green plants use a process called photosynthesis to create…

Q: match the venue diagram

A: Cystic fibrosis It is an autosomal recessive disease. It is characterized by the buildup of thick,…

Q: i. Tabulate the parts and functions of the microscope

A: Introduction A laboratory tool called a microscope is used to examine specimens that are too small…

Q: A man and his wife are both heterozygous for brown eyes. They have ix children all of whom have…

A: Genetic Recombination: The exchange of genetic material between distinct organisms, commonly…

Q: Match the description with the correct term. the idea that different mating calls of birds used…

A: Introduction Evolution refers to the change of characteristics of a population that can be inherited…

Q: TRUE OR FALSE: • Digestive secretions from the ● small intestine complete the digestion of…

A: Introduction Digestion is a process in which the food that we consume moves through the digestive…

Q: Womersley number (a) of a human aorta is 20 and for the rabbit aorta is 17, the blood density is…

A: Given information For human aorta Womersley (αh) = 20 Viscosity (μh) = 0.0035 Ns/m2 Diameter= 2 cm=…

Q: TRUE OR FALSE: asap Digestive secretions from the small intestine complete the digestion of…

A: Digestion is the process by which large insoluble food molecules are broken down into small…

Q: The following diagram shows two pairs of homologous chromosomes. One pair of homologous chromosomes…

A: The sexually reproducing organisms produce gammates that are the unit of sexual reproduction. The…

Q: Which statement best describes how diving mammals are different than mammals that are not adapted…

A: Introduction :- Warm-blooded creatures known as mammals have three middle ear bones, sweat glands,…

Q: ii) In order to create a western blot, SDS-PAGE is first performed to separate the proteins. After…

A: SDS-PAGE is a protein separation procedure, most widely used in immunoblotting. It can be done once…

Q: 5. If dividing cells are grown in a culture medium containing radioactive thymidine, the thymidine…

A: In case of eukaryotic organism, cell containing nucleus, the cell cycle is categorized into two two…

Q: How does vasodilation reduce the body temperature?

A: Body temperature is maintained by the center present in the form of the hypthalamus. Hypothalamus is…

Q: Structure of globin mRNA

A: The cell consists of the genetic material, which can be either DNA or RNA. DNA is the…

Q: Name three functions of articular cartilage.

A: Articular cartilage is a specialized characterized to bear the large compressive joint loads and…

Q: Carnivore Herbivores Producers 2gm/m 8 gm/m² 4/gm/m² Inverted Pyramid in an Aquatic Ecosystem

A: Introduction :- Inverted pyramids are pyramids with a wide top and a narrow base.It indicates that…

Q: Choose the incorrect statement about skeletal muscle. Question 3 options: Skeletal muscle is…

A: Skeletal muscles account for 30 to 40% of total body mass. They are the muscles that connect to your…

Q: 1. Determine the inactivation rate constant (K) for a microorganism for the following treated…

A: The inactivation of microorganisms in a disinfection plant is determined by the length of time the…

Q: Consider the mating between two carriers for the recessive allele that causes albinism, Aa x Aa.…

A: A carrier is referred to as a person who has a change in only one gene pair and the other gene of…

Q: Suppose you were told that mining deep-oceanmineral resources would mean severely degradingocean…

A: Mining refers to process of extracting minerals by digging sea,land etc. Land resources are…

Q: 1.4 If galangin were tested, how would its antibacterial activity compare to that of the other…

A: Flavanoids are commonly seen in the plant kingdom and they are heterocyclic compounds. They can be…

Q: Cytoplasmic extensions of_______ send and receive chemical messages.a. glial cells c. fibroblastsb.…

A: Introduction The nervous system is the main controlling center of the body which controls all…

Q: Give examples of how the study of living materials requiresan understanding of chemistry.

A: Every matter is composed of elements or molecules. Molecules are composed of atoms and atoms are the…

Q: In fruit flies, yellow body is a sex linked recessive allele. The dominant allele is dark bodied. If…

A: A bleeding ailment called haemophilia causes blood to not clot normally. Blood contains a variety of…

Q: metabolic scope

Q: Identify a disorder/disease/condition that is either a result of poor nutrition or improper…

A: The food is required to maintain the nutritional requirement of the body. The deficiency of a…

Q: Compare renewable versus nonrenewable resources.

A: Introduction Ecological Footprint (EF) represents the demand of a person or a group of a person on…

Q: Can an epidemiologist who finds a correlation between the use of tanning beds and melanoma (an…

A: Introduction Epidemiology is a study that provides information about a health-related concern in a…

Q: Which of the following statements is true about certainty of paternity? Question 12 options:…

A: The degree in which a putative parent can be positive whether he, she, or it is the parent of a…

Q: Harry Potter speaks parseltongue (he can talk to snakes). Dumbledore explains that this is because…

A: Introduction Gene is the basic structural and functional unit of heredity. Gene controls all the…

Q: (2) a. Mineral salt is essential for growth of a plant. The process responsible for absorption of…

A: Mineral salts are very necessary for the growth of the plant. These are absorbed from the soil. Some…

Q: Please fast doing explain also.

A: MeV, a negative-sense RNA virus with a nonsegmented genome and lipid envelope, is a member of the…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: if there are 1,000,000 bacteria and 90% of them are killed, how many bacteria remain?

A: Bacterial growth is an orderly increase in the quantity of cellular constituents and number. It…

Q: A.) Answer the following questions: 1. What is an ecosystem? 2. Identify the different types of…

A: Introduction Ecology is the study of interactions between living things, such as humans, and their…

Q: What is the current understanding of hormones in the pathophysiology of prostate cancer?

A: Introduction A tumor is nothing but uncontrolled cell division, which can lead to the formation of…

Q: The light compensation point of a sun leaf is higher or lower than a shade leaf? Higher Lower

A: Light compensation point ( LCP ) LCP is the point on the light curve where the light intensity at…

Q: Consider the steps involved in an experiment that uses the scientific method. Arrange the six given…

A: A scientific method is a systematic method of approach to research developed in the 17th century.…

Q: Fourteen NADPH molecules are required to produce one molecules of palmitic acid from acetyl CoA.…

A: Introduction Fatty acid synthesis is the process by which fatty acids are produced from acetyl-CoA…

Q: When the mammalian brain compares the actual temperature of the body to the preferred temperature of…

A: The cerebrum, brainstem, and cerebellum make up the brain. It is in charge of the majority of the…

Q: Which of the following is true about the immune system? Check all that apoply. Rejecting organs or…

Question

When the skin is exposed to sunlight it will produce:
Calcium
Vitamin D
Vitamin C
Vitamin D
precursors
I

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A stiff neck due to spasmodic contraction of the neck muscles that pull the head toward the affected side is known as _________, or wryneck.
Carlotta Hansen has blister-like sores on her lips and adjacent facial tissue. She says they are cold sores; however, the medical term for this condition is_________.
The medical term for the condition commonly known as low back pain is lumbaego _________________
The protective sheath that covers the brain and is CLOSEST TO THE SKULL is the Dura Mater Pia Mater Arachnoid process Subarachnoid space
What part is best examined for pallor? The major sign of iron deficiency anemia is pallor. Palms Nailbeds Around the lips Lower conjunctival sac Why Option 1 (Pallor) is the correct answer? Why not Option 2, 3, and 4?
What part is best examined for pallor? The major sign of iron deficiency anemia is pallor. Justify correct and incorrect answer. A. Palm B. Nail Beds C. Around the lips D. Lower conjunctival sac
A 56-year-old female had been experiencing some difficulty reading books and newspapers. In order to retain the text in focus while reading, she kept the text at an arm’s length away. The woman is exhibiting: a. delusion b. presbycusis c. presbyopia d. emmetropia e. cataract
Give the reason why petechiae found within ½ inch from the area where the sphygmomanometer cuff is placed be disregarded.