Below is a nucleotide base pair from B-DNA with three different regions indicated by A, B, and C. B N A Which of the following descriptions of regions A, B, and Care INCORRECT? A = minor groove, water spine, sugar edge All choices presented are correct C-major groove, Watson-Crick-Franklin edge B = major groove, Hoogsteen edge A minor groove, sugar edge H. C N--H

Below is a nucleotide base pair from B-DNA with three different regions indicated by A, B, and C. B N A Which of the following descriptions of regions A, B, and Care INCORRECT? A = minor groove, water spine, sugar edge All choices presented are correct C-major groove, Watson-Crick-Franklin edge B = major groove, Hoogsteen edge A minor groove, sugar edge H. C N--H

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Similar questions

Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?
For entertainment on a Friday night, a genetics professor proposed that his children diagram a polynucleotide strand of DNA. Having learned about DNA in preschool, his 5-year-old daughter was able to draw a polynucleotide strand, but she made a few mistakes. The daughter’sdiagram (represented here) contained at least 10 mistakes. Q. Make a list of all the mistakes in the structure of this DNA polynucleotide strand.
. The DNA polymerases are positioned over the following DNA segment (which is part of a much larger molecule) and moving from right to left. If we assume that anOkazaki fragment is made from this segment, what will be the fragment’s sequence? Label its 5′ and 3′ ends. 5′.…CCTTAAGACTAACTACTTACTGGGATC….3′ 3′.…GGAATTCTGATTGATGAATGACCCTAG….5′
Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAA
Given the sequence of DNA strand 1, determine the correct sequence for DNA strand 2 based on nucleotide base-pairing rules. DNA strand 1: 5’ A T G A G A C T G A T T 3’ DNA strand 2:
If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? 5'-TGACTAACTG-3' 3'-TGACTAACTG-5' 3'-CAGTTAGTCA-5' 3'-TGACTAACTG-5'
Which of the following would represent a section of DNA with a palindromic sequence? 5' TAT CCG 3' 5' GGA CTT 3' 5' TTT CCA 3' 5' CAT ATG 3'
When a double-stranded DNA molecule is exposed tohigh temperature, the two strands separate, and themolecule loses its helical form. We say the DNA hasbeen denatured. (Denaturation also occurs whenDNA is exposed to acid or alkaline solutions.)a. Regions of the DNA that contain many A–T basepairs are the first to become denatured as the temperature of a DNA solution is raised. Thinkingabout the chemical structure of the DNA molecule, why do you think the A–T-rich regionsdenature first?b. If the temperature is lowered, the original DNAstrands can reanneal, or renature. In addition to thefull double-stranded molecules, some molecules ofthe type shown here are seen when the moleculesare examined under the electron microscope. Howcan you explain these structures?
Which of the following is true about the denaturation of double-helical DNA? A. Denaturation increases with decreasing temperature. B. Denaturation is accompanied by an increase in the absorption of UV light by DNA. C. G-C rich DNA melts at lower temperature than A-T rich DNA. D. Once denatured, DNA strands cannot anneal.
If one DNA strand has the nucleotide sequence below, what is the nucleotide sequence on its complementary strand? 5’ACCGATTACGATTACG3’ If the template DNA strand has the nucleotide sequence below, what is the nucleotide sequence on mRNA? 5’ACCGATTACGATTACG3’ In the chart below, indicate the unique structural or functional characteristics of DNA and RNA, as well as their similarities. Be very specific. Unique DNA characteristics Similar characteristics Unique RNA characteristics
Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA template strand.DNA Strand: TCT AAC TAT CCC CTA Third codon change from TAT to TAG. Second codon change from AAC to ATC. Nucleotide with adenine (A) base inserted between 14th and 15th nucleotide. Ninth nucleotide changes from T to C.
The line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is shown which is ok for our purposes (but remember that the other strand would also be present in DNAà but it is ok for us to ignore). This is very similar to a problem on the old tests. For each letter state the structure or the function of what occurs at that region. Letter A is Letter B is Letter C is Letter D is Letter E is Letter F is Letter G is To which region/letter would RNA Polymerase bind To which region/letter GTF bind Label the position of the start codon ATG and the stop codon TGA The picture below is for the question itself