Which enzyme listed below is considered both a component of the citrate cycle and a component of the electron transport system? citrate synthase, which catalyzes the reaction acetyl-CoA + oxaloacetate --> citrate Malate dehydrogenase, which catalyzes the reaction malate + NAD+ -> NADH + H+ + oxaloacetate Succinate dehydrogenase, which catalyses the reaction succinate + FAD -> fumarate + FADH2 Succinyl-CoA synthetase, which catalyses the reaction. succinyl-CoA + GDP + Pi -> succinate + GTP
Q: 15-24 b) c) Identify the molecules oxidized and reduced in the following reactions: a) CH₂CH₂CHO +…
A: Many redox reactions occur during metabolism. Redox reactions necessitate the transfer or removal of…
Q: Which electrolyte is most effected by hemolysis?
A: Hemolysis is the process of breakage of red blood cells. Hemolysis can be occurred due to viral and…
Q: If the target protein is 0.1% of the total protein in the original mixture, a three-step…
A: Purification is a process by which impurities are removed from a sample and desired component is…
Q: CH3C(double bond with O)COO- (aq) + H2O(l)⇌ Pyruvate, a product of glucose metabolism Express your…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that oxidises a 1 molecule of…
Q: Please answer both Note :- Other wise down vote.
A: The reactions that involve biomolecules are called biochemical reactions. These occur inside the…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: Glucose and fructose are monosaccharides. Glucose is an aldose sugar and fructose is a ketose sugar.…
Q: could you please write the equation on paper with pen? I cannot understand the equation clearly.
A: The competitive inhibitors are the molecules which inhibits the enzyme catalyzed reaction by binding…
Q: Questions 11-13- refer to the carbohydrate mannose (open chain and one anomeric ring configuration…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Structure and biological role of phosphatidic acid.
A: The smallest and most basic phospholipid, phosphatidic acid (PA), serves as a precursor for other,…
Q: 2. Scheme of anaerobic oxidation of glucose and energy balance.
A: Organisms that live under anaerobic conditions rely only on glycolysis to generate ATP. Glycolysis…
Q: Select ALL statements that are true about the isoelectric point (pI) of a protein a.Protein carries…
A: The isoelectric point (pI) of a protein is the pH at which the protein is neutral or the overall…
Q: Which of the following is TRUE under the following conditions: the enzyme concentration is 2.5 nM,…
A: The rate of reaction can be determined by using Michaelis Menten equation. Michaelis Menten equation…
Q: Experiment: DNA Extraction from Banana The procedures are attached below. Question: 1. Will the…
A: DNA is the genetic material that is presented inside the nucleus of every cell. Banana is the best…
Q: Which of the following occurs during the second round of the Q cycle (oxidized coenzyme Q =…
A: The Q cycle shows the sequential oxidation and reduction of CoQ, between the ubiquinol and…
Q: Respiratory acidosis results from hypoventilation (decreased respiratory rate) causing a decreased…
A: All biological processes are pH dependent. Even a slight change in pH can result in a large change…
Q: Consider a protein with two surface-exposed histidine residues: HisA is a “typical” histidine…
A: The Henderson-Hasselbalch Equation for the deprotonation of a species is given below. pH= pKa +…
Q: 17-21 Is the rea (PEP) a re
A: Glycolysis is the process of breaking down glucose into two pyruvate molecules results in the…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: A dipeptide is a two amino acid linked via a peptide bond. The peptide bond is formed between the…
Q: B Which of the following is a Receptor Tyrosine Kinase? a. adenylyl cyclase b. B-adrenergic receptor…
A: Tyrosine kinases are enzyme that phosphorylates their substrate at the tyrosine residue. Tyrosine…
Q: Choose the best answer for each blank. The pyruvate dehydrogenase (PDH) complex is regulated by the…
A: Glucose is oxidized during glycolysis and the end product (pyruvate) is converted to Acetyl CoA via…
Q: Q3
A: Citric acid cycle : It is a metabolic pathway that converts carbon atoms to CO2 and, in doing so,…
Q: Draw the structure of alanylserine, a dipeptide made from alanine and serine, as it would appear at…
A: A dipeptide has two amino acid residues. Amino acid sequences are written with N-terminal amino…
Q: Draw structure of Cytosine, Thymine and Uracil and describe the difference in the structure?
A: Nucleotides vs nucleosides Nucleosides are pentose sugar(ribose in the case of RNA and deoxyribose…
Q: Given a peptide chain that is composed of the following amino acids: (branched chain-- polar…
A: Chromatography is a separation technique by which amino acids dissolved in a mobile phase are…
Q: Use a schematic diagram to briefly summarize the steps taken during the separation, isolation, and…
A: Milk is the secretion of fluid from the mammary gland, the milk is composed of ~88% water and ~12%…
Q: How similar of an effect would a mutation in pyruvate dehydrogenase have, compared to a mutation in…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate by…
Q: What percentage of molecules of peptide GGGG has no ionized groups (e.g. has BOTH protonated…
A: Amino acids: An amino acid can function as both an acid and a base because of its structural…
Q: How does alteplase and mannitol affect a laboratory result? Why is it important to inform the lab…
A: Introduction An ischemic stroke is a condition when the blood supply to part of the brain is reduced…
Q: Complete the balanced equation for the overall reaction by selecting an answer choice in the…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: What are ketone bodies and why do they form during fasting?
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: Reaction of alkaline, acid and enzymatic hydrolysis of triacylglycerols.
A: Triacyl glycerols are triglycerides which are formed from 3 molecules of fatty acids and one…
Q: Symport and antiport proteins must be active transport proteins A)True B)False
A: The biological membranes are selectively permeable. Transport across the biological membrane can be…
Q: What is true about lipids? A. They are polar and therefore soluble in polar solvents B They are…
A: The four classes of biological macromolecules are nucleic acids, proteins, lipids and…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: Enzymes are proteins that act as biocatalysts. Enzymes are classified into six classes based on the…
Q: C. Mucic Acid Test for Galactose and Lactose describe the appearance of a few typical crystals…
A: Galactose and lactose can be found using the highly specific mucic acid test, which is used to…
Q: b-oxidation occurs ONLY under aerobic conditions. Why? Glycolysis occurs under anaerobic conditions,…
A: Beta-oxidation of fatty acids is the process by which long chain fatty acid molecules are broken…
Q: After doing the preliminary studies on redcrest protein extract, Tighnari proceeded with its…
A: Proteins are macromolecule comprised of amino acids linked by peptide bonds which forms a primary…
Q: 4. Amphiphilic Lipids. Detergents are small amphiphilic molecules that tend to form micelles in…
A: Ionic detergents contain anionic or cationic head group long with their hydrophobic tails being…
Q: please explain how to solve this type of questions
A: Each amino acid's preference for the alpha or beta secondary structure can be estimated. The…
Q: The pancreas is an organ of mixed secretion. Endocrinely, beta-cells produce the hormone insulin,…
A: Pancreas has 3 types of cells: α cells secrete glucagon β cells secrete insulin δ cells secrete…
Q: 3. Why can DNA adopt both A- and B- forms, while RNA is restricted to the A-form?
A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…
Q: Over the course of glycolysis and the citric acid cycle, there are 10 NADH and 2 FADH₂ produced per…
A: Number of ATP formed from each molecule of NADH and FADH2 through oxidative phosphorylation helps in…
Q: Briefly describe the role of the heat shock protein Hsp70 in protein folding.
A: Heat shock proteins (HSPs), also referred to as stress proteins, are a group of efficient proteins…
Q: Show a calculation of change in standard reduction potential that explains why succinate is not…
A: When two half reactions are paired in a redox reaction, the half reaction with the higher E°' will…
Q: How does ATP regulate the activity of PFK-1? ATP binds to PFK-1 at the catalytic site as a…
A: The enzyme phosphofructokinase 1 (PFK-1) catalyzes the following reaction: Fructose 6-P + ATP –>…
Q: How many mL of 19 mM SDS would you need to make 76 mL of 2 mM SDS? Report your answer rounded to 1…
A: Molarity is a way of representing the concentration of a solution. Molarity is the number of moles…
Q: 5. Reciprocal regulation of glycogen phosphorylase and glycogen synthase activity.
A: Enzymes are proteins that aid in the speeding up of chemical reactions. Enzymes bind to substrates,…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Kinesin movement is dependent on GTP hydrolysis. True False
A: Kinesin is a motor protein that is essential for the cellular functions like mitosis, transport of…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Study Figure 19.18 and decide which of the following statements is false. Pyruvate dehydrogenase is inhibited by· NIADH. Pyruvate dehydrogenase is inhibited by AΤΡ. Citrate synthase is inhibited by NADH. Succinyl-CoA activates citrate synthase. Acetyl-CoA activates pyruvate carboxylase.Complete oxidation of a 16-carbon fatty acid can yield 129 molecules of ATP Study Figure 19.2 and determine how many ATP molecules would be generated if a 16-carbon fatly acid were metabolized solely by the TCA cycle, in the form of S acetyl-CoA molecules.Based on your knowledge of the structure of NAD+ and an assumption that coenzyme dissociation is the rate limiting step of the alcohol dehydrogenase mechanism, hypothesize why a N249W mutation at the coenzyme binding site would increase the rate of catalysis.
- Which of the following is the third step of Citric Acid Cycle? Select one: a. Succinyl-CoA becomes Succinate and forms one ATP molecule and Coenzyme A-SH b. Pyruvate is decarboxylated to become acetyl-CoA producing NADH and Carbon dioxide c. Isocitrate and then decarboxylated and oxidized to produce alpha-ketoglutarate, Carbon dioxide and NADH d. alpha-ketoglutarate is oxidized and decarboxylated to produce Succinyl-CoA, Carbon dioxide and NADH e. Succinate is oxidized to become fumarate forming FADH2 f. Oxaloacetate combines with the acetyl from acetyl-CoA to produce Citric acid(citrate) g. Citrate is rearranged to become Isocitrate h. Malate is oxidized to become oxaloacetate forming NADH i. Fumarate is combined with water to become MalateDetermine the ATP production of glucose catabolism by glycolysis and Krebs Cycle using the following information: 1. Glycolysis: Net 2 ATP, 2 NADH + H+2. Pyruvate --> acetyl CoA: Produces 2 NADH + H+/glucose3. Krebs Cycle --> 2 FADH2 + 2 ATP + 6 NADH + H+/glucose 2.5 ATP are produced/NADH + H+ delivered electron to the electron transport system1.5 ATP are produced/FADH2 delivered electron to the electron transport systemWhich of the following is the second step of Citric Acid Cycle? Select one: a. Isocitrate and then decarboxylated and oxidized to produce alpha-ketoglutarate, Carbon dioxide and NADH b. Succinyl-CoA becomes Succinate and forms one ATP molecule and Coenzyme A-SH c. alpha-ketoglutarate is oxidized and decarboxylated to produce Succinyl-CoA, Carbon dioxide and NADH d. Malate is oxidized to become oxaloacetate forming NADH e. Fumarate is combined with water to become Malate f. Citrate is rearranged to become Isocitrate g. Pyruvate is decarboxylated to become acetyl-CoA producing NADH and Carbon dioxide h. Oxaloacetate combines with the acetyl from acetyl-CoA to produce Citric acid(citrate) i. Succinate is oxidized to become fumarate forming FADH2
- In order for an adipose cell to synthesize decanoic acid, it will need substrates in the form of _______ ATP, _______ NADPH from the transport of citrate into the cytoplasm and the subsequent recycling of oxaloacetate, and _______ NADPH from the pentose phosphate pathway. You can ignore the ATP used to regenerate mitochondria oxaloacetate via pyruvate carboxylase.Which statement does NOT describe a general function of the pentose phosphate pathway? Group of answer choices The pentose phosphate pathway is used to produce NADPH for reductive biosynthesis in adipocytes. The pentose phosphate pathway allows for the entry of dietary pentose intermediates into the glycolytic pathway. The pentose phosphate pathway produces reduced molecules whose electrons may be shuttled to the mitochondria for oxidative phosphorylation. The pentose phosphate pathway allows for the conversion of hexoses into pentoses that may be used as precursors in the synthesis of nucleosides.Which of the following events does not occur during Krebs Cycle? Citrate synthase catalyzers the transfer of an acetyl group from acetyl coenzyme A to oxaloacetate to form citrate. Isocitrate dehydrogenase converts citrate to its isomer isocitrate. A carbon dioxide is released when alpha-ketoglutarate is oxidized to succinyl coenzyme A. The energy released from the conversion of succinyl coenzyme A to succinate is used to transfer a phosphate group to ADP to form ATP. During Krebs Cycle, succinate is oxidized to fumarate which is coupled to the reduction of FAD to FADH2. During electron transport, the electrons from FADH2 are transferred to coenzyme Q. Which of the following catalyzes these reactions? NADH dehydrogenase Succinate dehydrogenase FADH2 hydrogenase NADH hydrogenase reductase
- Taking into consideration glycolysis, the pyruvate dehydrogenase complex and the citric acid cycle, how many NAD+ molecules are reduced from a single molecule of dihydroxyacetone phosphate? 4 NAD+ are reduced 5 NAD+ are reduced 8 NAD+ are reduced 10 NAD+ are reduced None of the above answers are correctArsenate can replace inorganic phosphate in the reaction catalyzed by glyceraldehyde-3-phosphate dehydrogenase, causing glyceraldehyde-3-phosphate to be directly converted to 3-phosphoglycerate(NADH is still formed). Which of the following is absolutely true in case of arsenate poisoning -Glycolysis will stop - Glycolysis will still proceed with no net ATP gain - Glycolysis will not generate any form of energy - Glycolysis will still proceed, but with a net consumption of ATP - Glycolysis will proceed with lactate as end productWhich of the following molecules shown are the reduced products produced in the citric acid cycle whose reduction directly helped drive oxidation? Select all that apply. Ensure you are selecting the product forms of the molecule, which here means the reduced form, and are only considering redox reactions! Do not include the pyruvate processing steps -- just the citric acid cycle itself. A. GDP B. NADH C. FAD D. Acetyl-CoA E. NAD+ F. CoA G. FADH2 H. GTP I. QH2 J. Q