Q: Please answer fast The immune system uses two different pathways to eliminate intracellular and…
A: Adaptive immune responses include cell-mediated and humoral immune responses.
Q: Mutation in the operator that reduces the affinity of the operator for the repressor protein…
A: Lac operon is an inducible operon. When lactose is present in medium, then lac operon starts.
Q: first cigarette
A: Nicotine is the addictive drug. It actually occurs naturally in tobacco leaves. But it's not until…
Q: INEPT 1)What happened in the first 90 degree pulse ? 2)What does anti-phase magnetization?(use…
A:
Q: Steroid hormones are required by the body at puberty and into adolescence to regulate growth and…
A: Anabolic steroids are hormones that promote tissue growth and cell division. Catabolic steroids are…
Q: गत 1. जीवों को वर्गीकत क्यों करते हैं? अ
A: Introduction: Living organism classification is the division of living organisms into several groups…
Q: In the biotechnology industry, lysine is produced by fermentation using which of the following?…
A: Lysine is a alpha amino type of amino acid which is precursor for many proteins. It contain alpha…
Q: Use the following diagram to answer the question below. XNXXX -G---C a. Guanine. b. Thymine. c.…
A: Introduction Deoxyribonucleic acid, also known as DNA, is the molecule that carries the genetic…
Q: You are doing a genetics experiment with the fruit fly. In the "F1" generation, you cross two…
A: According to Bartleby guidelines, the first three subparts have been answered kindly post the…
Q: Which of the following rows indicates this pregnancy hormone and the correct location of production?…
A: Introduction Pregnancy is an event in which the fertilised egg cell starts developing into an embryo…
Q: A communicable disease is... O a disease that is easily spread from one host to another. O O a…
A: A disease is a specific abnormal condition that adversely affects the structure or function of all…
Q: Plasma membranes in the cells of cold-blooded animals usually have a higher proportion of…
A: Introduction: The plasma membrane, also known as the cell membrane, is the membrane found in all…
Q: Which one of the options below best describes where the water column meets the sea floor? The…
A: Depending upon the light availability and depth ,there are different zones categorised in the marine…
Q: Explain in detail how these factors: the size of bioaerosol, inspiratory flow rate, flow pattern,…
A: Introduction: Bioaerosols are particles that are released into the air from marine and terrestrial…
Q: 13. A dominant x-linked allele (B) gives normal color vision but the recessive allele (b) causes…
A: Please follow steps 2,3,4 for detailed explanation.
Q: )You measure the effects of a single allele (A2) on fitness in two populations of the same plant…
A: The average excess of fitness is a measure of the fitness of a particular allele (say, A2). It can…
Q: phagocytosis
A: White blood cells engulfing bacteria. The process where these white blood cells surround, engulf,…
Q: describe the environmental factors that influence indoor fungal contamination.
A: The indoor environment has a significant impact on public health. Allergies, infection, and…
Q: Standard protein NaCl (ml) solution* (ml) 0 0.1 0.2 0.3 0.4 0.5 Table 1.... 898765 1.0 이이이이이 0.9 0.8…
A: Protein standard curve is used to determine the concentration of an unknown protein sample. It is…
Q: The Organ of Corti is contained inside:
A: This question is related to anatomy of ear.
Q: Given that II2 has cystic fibrosis, what is the chance that III8 will be a carrier of the CF allele?…
A: Cystic fibrosis (CF) Is one of the most common hereditary disorders, affecting approximately one…
Q: 7. The ability to roll your tongue (R) is dominant to lack of this ability (r). A. What is…
A: 7A 'R' is the dominant allele, while 'r' is the recessive allele. Here, the following…
Q: IgA Proteases are enzymes that...
A: Introduction Proteases are the enzymes that break down peptides and proteins.
Q: relationship between parasites, people and poverty using the “lever model” of health
A: The abnormal condition of the body negatively affects the various structures or the biochemical…
Q: O prodromal period
A: The five periods of disease (sometimes referred to as stages or phases) include the incubation,…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…
A: Given DNA strand: 5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'
Q: Please answer all the Qs below : Which statement about the HLA complex is TRUE? True False A.…
A: HLA or human leukocyte antigen are the protein markers which ensure that every transplanted organ…
Q: These are examples of environmental factors that influence indoor fungal contamination: Outdoor…
A: Answer :- The indoor environment essentially affects general wellbeing. Sensitivities, disease, and…
Q: vehicle transmission
A: person can get cholera by drinking water or eating food contaminated with the cholera bacterium.…
Q: what could have happened to the isolates when she re-streaked them repeatedly and recommend a…
A: Mangroves are part of the coastal ecosystems in the sub-tropical and tropical regions across the…
Q: What are the demand rate of the patient turning apparatus shown in the picture, place of demand, age…
A: Changing the position of a patient is of utmost importance in patient care as it helps to alleviate…
Q: D. If a man is color-blind, which parent did he inherit the gene from? Explain your answer. E.…
A: Ability of your eyes when its difficult to perceive red & green colour is called colour…
Q: Standard 5a 1. What phenotypic variation (Vp) is present in this case study of beach mice? 2. What…
A: Introduction Evolution is the shift in a biological population's heritable traits over successive…
Q: Name of virus Herpes viruses RNA or DNA Double stranded (ds) or Single Stranded (ss) Linear or…
A: The first-generation herpesvirus, Herpes simplex virus type 1 (HSV-1), has a linear double-stranded…
Q: The gel image below shows 7 alleles, let's call them 1-7 in order of size, with 1 being the largest…
A: In agarose gel electrophoresis, DNA fragments are separated according to their size (or the number…
Q: The following are the offspring produced by the cross of AaBBCc X AaBbCC, except: a. AABBCC b.…
A: Trihybrid cross is the cross between the two individuals of a species for studying inheritance of…
Q: Describe two roles where ABA shows to be rather ecological and physiological significance to the…
A: Abscisic acid (ABA) is a crucial hormone that plays a significant role in regulating responses to…
Q: What do restriction enzymes do
A: What do restriction enzymes do ?
Q: detail three microscopic techniques, one of which should be the FISH technique, which can be used to…
A: Microscopy is the most essential invention that covers a multiple processes and its detection. This…
Q: Analyze the connection between body weight and the human gut flora.
A: Numerous microorganisms necessary for the body's proper operation are found in the human body. As…
Q: g Toll-like receptor
A: Macrophages work as innate immune cells through phagocytosis and sterilization of foreign substances…
Q: Define and describe protozoans. Explain how their presence in this world is significant.
A: Introduction :- Microscopic unicellular eukaryotes known as protozoa have a very complicated…
Q: Which is the correct equation for the chisquare statistic? Group of answer choices a)x^2 =…
A: Introduction The process of studying and investigating in areas of science that involve genetics…
Q: Explain the similarities and differences between the green and brown food webs. How are they…
A: A green food cycle (in the outer cove) and a brown food cycle (in the inner cove). The greenland…
Q: Do phantom perceptions arise from erroneous neural signals from an amputated stump, or from residual…
A: This phenomenon is related to the conscious feeling of the presence of a missing body part like a…
Q: In a study of coat colour in beach mice, researchers measured the darkness of the fur on the backs…
A: (Change)Here the relation of offspring phenotypes is studied on the basis of mid parent value i.e.…
Q: Refer to the following illustration to answer the questic The illustration shows: O a lysogenic…
A: The transposable genetic element also named as mobile genetic element or jumping genes. They can be…
Q: 1. Gastric juice has a H+ concentration of 10-3 M. What is the pH of gastric juice? 3 2. The pH of…
A: Introduction : pH is a numeric scale in chemistry that is used to determine whether the substance…
Q: Yeast cells are added to sterilized corn mash in large industrial fermenters to produce ethanol,…
A: Fermentation is a metabolic mechanism in which a carb, such as starch or sugar, is converted into an…
Q: What is assimilation efficiency? How/why would assimilation efficiency differ for herbivores eating…
A: Answer : it is the food percentage taken by the consumers which are mainly herbivores. The intake of…
which heart valve is circle in the image
explain some points about that valave and work too
thank you asap
Step by step
Solved in 2 steps
