Which of the following cannot be fixed in the cell and canlead to permanent damage in the DNA?Select one:a. Mutated proof-reading enzymeO b. Various alkylation productsc. Spontaneous depurinationO d. Thymine dimerse. Oxidative lesions

DNA damage takes place due to various causes. This DNA will ultimately cause conformational changes…

Which of the following cannot be fixed in the cell and can lead to permanent damage in the DNA? Select one: a. Mutated proof-reading enzyme b. Various alkylation products c. Spontaneous depurination O d. Thymine dimers e. Oxidative lesions

Which of the following cannot be fixed in the cell and can lead to permanent damage in the DNA? Select one: a. Mutated proof-reading enzyme b. Various alkylation products c. Spontaneous depurination O d. Thymine dimers e. Oxidative lesions

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 5RQ: The initial mechanism for repairing nucleotide errors in DNA is _____. a. mismatch repair b. DNA...

See similar textbooks

Related questions

Q: High concentrations of nuclear CyclinD is required for entry into S phase. Which of these events…

A: CELL DIVISION : It is necessary for all the cells. In this the parent cell divides itself into new…

Q: During DNA replication, as DNA unwinds it can become supercoiled causing twists that stress the…

A: DNA (deoxyribonucleic acid) is a double-stranded molecule in which the two strands wind around each…

Q: The original DNA base sequence is 5’-AGCGTTACCGT-3’; a mutation in the DNA strand results in the…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: The two complementary strands of the DNA double helix are held to each other by (a) ionic bonds…

A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…

Q: Which of the following statements is not true? Explain why. A. A DNA strand can serve as a template…

A: DNA is deoxyribonucleic acid. The nucleic acids are the building blocks of DNA molecules. DNA is a…

Q: Which of the following is NOT correct regarding DNA and RNA synthesis? Select one: a. The overall…

A: Replication is the process by which, DNA is copied. Where transcription is the process by which DNA…

Q: The enzyme responsible for the joining of Okazaki fragments is a. helicase b. primase c. DNA ligase…

A: Okazaki fragments are DNA nucleotides with short sequences having approximately 150 to 200 bps (in…

Q: Describe what happens to the DNA when the helicase unwinds the double helix. What can Topoisomerases…

A: it occurs during DNA replication.

Q: If a person is lacking a gene that codes for a protein involved in nucleotide excision repair, then…

A: DNA can experience a variety of chemical reactions, as in any other molecule. However, since DNA is…

Q: intrastrand; same

A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material which has all the stored genetic…

Q: Which of the following is/are true regarding the enzyme primase? a: primase functions during…

A: DNA replication occurring in all organisms is the process of producing identical copies of DNA from…

Q: Enzyme function is critically important for the proper replication of DNA. Predict the consequence…

A: Enzymes are biological catalysts that enhance the speed of a reaction. This is performed by lowering…

Q: How will each of the following substances or conditions affect DNA structure? a. ethanol; b. heat;…

A: Deoxyribonucleic acid or DNA is a molecule composed of two polynucleotide chains that coil around…

Q: The following enzymes cannot catalyze the synthesis of DNA A.DNA polymerase B.DNA gyrase…

A: DNA is the genetic material of an organism. DNA replication is a process in which two DNA molecules…

Q: A mutation is most often cause by which of the following factors? a) Sunlight b) Smoking c)…

A: First let us understand, what is mutation? Mutation simply means change in sequence of DNA at the…

Q: To make a new DNA strand, which of the following is necessary? a. A template strand c. Heavy…

A: The separating process of strands of the double helix would provide two templates for the synthesis…

Q: Describe two ways by which DNA is released from cells.

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: The following statements are correct EXCEPT: A) Information in the DNA is transcribed int mRNA and…

A: DNA is a genetic material which is safely stored inside the nucleus of the cell . It is ladder like…

Q: One of the mechanisms that leads to the DNA mutations is a process known as DNA polymerase slippage…

A: DNA slippage is a type of DNA strand misfiring mechanism that occurs in the repeated nitrogenous…

Q: Eukaryotes such as humans have linear chromosomes. In order to signal the end of DNA replication,…

A: DNA replication is a process by which two identical copies of DNA are made. It is completed in 3…

Q: Define the following terms: a. tiRNA b. monocistronic c. snRNPs d. antisense DNA strand e. sense DNA…

A: There are different types of DNA, RNA and proteins molecules available. Each of which perform…

Q: Ultraviolet light principally causes which of the following dmages to DNA? A methylation of specific…

A: UV light can kill cells by damaging DNA to an irreversible extent. The light initiates reaction…

Q: Which of the following complex compound is used in the treatment of cancer?A. Cis platin B.…

A: Cancer: An abnormal growth of cells which tend to proliferate in an uncontrolled way and, in some…

Q: Which of the following enzymes is NOT involved in DNA replication? a. DNA Polymerase b.…

A: DNA replication occurs before cell division in both prokaryotes and eukaryotes.

Q: All transposons would have these components among A- D EXC A) O transposase B) O insertion sequences…

A: Transposable elements are those DNA sequences that move from one location on the genome to…

Q: Neutralizing their positive charges would have which effect on the histone proteins? a. They would…

A: Histones are the proteins molecules that are positively charged, found in eukaryotic cells. The…

Q: You are studying a colony of cells and determine that some of these cells have a mutated DNA…

A: Deoxyribonucleic acid (DNA) is a hereditary molecule that passes genetic information from one…

Q: Discuss the following statement: “the DNA repair enzymes that fix deamination and depurination…

A: DNA is made up of two connected strands which loop about each other like a helix structure, giving…

Q: Which of the following does the enzyme primase synthesize? a. DNA primer b. RNA primer c. Okazaki…

A: Primer RNA is RNA that initiates DNA synthesis. Primers are required for DNA synthesis because no…

Q: Which of the following items do not affect the melting temperature of DNA? A length of the DNA B the…

A: Melting temperature ( Tm): half of DNA gets denatured (melts). Tm = 2* (A+T) + 4* (G+C)

Q: Which of the following statements is/are TRUE about DNA repair? Question 24 options: Ensure…

A: DNA repair It is a collection of processes by which a cell identifies and corrects damage to the…

Q: Base analogs are mutagenic because of which characteristic? a. They produce changes in DNA…

A: Mutagens are physical, chemical, or biological agent that induces mutation by changing the gene…

Q: Which of the following is NOT true of deoxyribonucleic acid (DNA)? A. None of the other four…

A: DNA - deoxyribonucleic acid is a polymer of nucleotides which acts as the genetic material in all…

Q: A. In the product, the underlined regions are called what? B. What functional groups are present in…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Which of the following is NOT common to all repair mechanisms? A. Detection of the lesion B. Removal…

A: A change in the fundamental structure of DNA that is not reproduced when the DNA is replicated is…

Q: . Which of the following statements best describe the mismatch repair pathway?a. It is part of the…

A: DNA polymerases include a group of enzymes that are responsible for the synthesis of DNA during DNA…

Q: You have a drug that blocks the activity of Primase during DNA replication. What are the steps in…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: The phrase “5 prime to 3 prime” refers to the_______ . a. timing of DNA replication b.…

A: The process by which DNA replicates to generate two daughter DNA strands that are identical to the…

Q: Several temperature-sensitive mutant strains of E. coli displaythe following characteristics.…

A: D.N.A. bio synthesis -- The synthesis of D.N.A. occurs when a cell divides and during division of…

Q: Which of the following enzyme is used to join bits of DNA? O ligase primase O DNA polymerase O…

A: DNA replication occurs in the nucleus of the cell. DNA replication leads to the production of…

Q: The following statements apply to compounds to which HONO, benzo(a)pyrene, aflatoxin, formaldehyde…

A: DNA is a polymer of nucleotides attached via phosphodiester bonds. Nucleotides are composed of a…

Q: Which of the following types of mutations are advantageous to cancer cell growth? a. Those…

A: DNA is the genetic material present in the genome of organisms.

Q: The problem of synthesizing the lagging strand, in the sense that DNA synthesis can only occur in…

A: DNA synthesis is the formation of new DNA molecules from the parental strand by utilizing…

Q: Which of the following is not required for Sanger sequencing of DNA? OA. ddNTPs B. DNTPS C. A DNA…

A: Sanger sequencing is a method of DNA sequencing.It involves selective incorporation of chain…

Q: Determine the following statements if they are true or false. a. In recombinant DNA technology, the…

A: A. False B. True C. True

Q: Define the following terms: a. transposition b. DNA glycosylase c. apurinic site d. apyrimidinic…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Define the following terms: a. processivity b. replisome c. exonuclease d. DNA ligase e. replicon

A: DNA represents the genome of a variety of organisms and can exist in single-stranded or double…

Q: Which of the following statements describe reversal of DNA repair mechanism. A. UV light blocks the…

A: Solution : correct option is C

Q: A mutant DNA strand was transcribed then translated to proteins. a. What is the protein product of…

A: A mutation is an abnormal change in DNA sequences that alters the protein product and is one of the…

Q: Oxidative deamination of adenine produces hypoxanthine (the base of inosine), which can base pair…

A: Mutations are the alteration in the nucleotide base in the DNA of the organisms. One of the…

Question

100%

Which of the following cannot be fixed in the cell and can
lead to permanent damage in the DNA?
Select one:
a. Mutated proof-reading enzyme
O b. Various alkylation products
c. Spontaneous depurination
O d. Thymine dimers
e. Oxidative lesions

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

What could be the consequences of loss of function the enzymes in the below: a. Helicase b. Primase c. RNA polymerase
Cystic Fibrosis is caused by which of the following? a. Replacement of three nucleotides with a new three nucleotide sequence b. Addition of three nucleotides c. Deletion of three nucleotides
The DNA polymerase I uses its to remove the RNA primers during DNA replication in E. coli cells. Select one: a. 3' to 5' exonuclease activity O b. 3' to 5' DNA helicase activity O c. 5' to 3' exonuclease activity O d. 5' to 3' DNA polymerase activity
Type of DNA spontaneous mutation that can explain why uracil is not found in DNA a.depurination b.methylation c. oxidation d.deamination
a. Pfu Polymerase b.dNTPs c.Buffer Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each. 1. unwinds DNA 2. synthesizes new DNA strands 3. enzymatically catalyzes Quikchange 4. nucleotide source for new DNA strands 5. Energy source for reaction(s) 6. Repairs errors in base pair matching 7. Maintains pH and salt levels 8. Creates polymer chains
Would the cell likely experience an issue due to the incorrect function of the protein produced by the following mutations? Why or why not? DNA 5' GCGATGCCCTAGGTATGA 3' normal с G a. DNA 5 GCGATGGCCTAGGTATGA 3' mutant b. DNA 5 GAGATGCCCTAGGTATGA 3' mutant c. DNA 5 GCGATGCCATAGGTATGA 3' mutant U UUU Phenylalanine UUC Phenylalanine UUA Leucine UUG Leucine CUU Leucine CUC Leucine CUA Leucine CUG Leucine AUU Isoleucine AUC Isoleucine AUA Isoleucine AUG Methionine (Start) GUU Valine. GUC Valine GUA Valine GUG Valine с UCU Serine UCC Serine UCA Serine UCG Serine CCU Proline CAU Histidine CCC Proline CAC Histidine CCA Proline CAA Glutamine CCG Proline CAG Glutamine ACU Threonine AAU Asparagine. ACC Threonine AAC Asparagine ACA Threonine AAA Lysine ACG Threonine AAG Lysine GCU Alanine. GCC Alanine GCA Alanine GCG Alanine. A UAU Tyrosine UAC Tyrosine UAA Stop UAG Stop GAU Aspartic Acid GAC Aspartic Acid GAA Glutamic Acid GAG Glutamic Acid G UGU Cysteine UGC Cysteine UGA Stop UGG CGU CGC…
Four enzymes are listed below, match each to the correct definition. Definition Enzyme 4. Ligase 5. Primase 6. Gyrase 7. Helicase Answer a. Unwinds DNA b. Relieves tension in DNA during unwinding c. Links sugars and phosphates together d. Builds RNA primers C В A
DNA replication requires ________ . a. DNA polymerase c. primers b. nucleotides d. all are required
1. Suicide enzyme will take in the alkyl group through its carbon atom from a cysteine residue. a. True b. False Answer: 2. These are the consequences of the changes in the messenger codon nucleotide sequence. a. Recombination b. Mutation c. Disease d. Abnormality Answer: 3. A.) Damaged DNA can be reversed if nucleotides can be replaced with a proper nucleotide for a correct amino acid base. B.) Direct reversal of DNA repair can destroy the abnormal bonds of the nucleotides in the DNA sequence. a. Statement A is correct b. Statement B is correct c. Both A and B are correct d. Both A and B are incorrect Answer:
If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. ATATATATCGCGTTAAATTCTA O b. GCGCGCGCGCGCGCGCGCGCG O c. AAAAAATTTTTCCCCCGGGGG O d. TACTACACTGTGGTTAATTAAA O e. GGGGGCCCCCAATTCCCCCCC tune of proteins that heln in regulating the levels of different molecules in human body, e.g
What type of mutation is represented in the second strand of DNA? 1. TACGGCACT2. TACGGAACT A. Insertion B. No Mutation C. Deletion D. Substitution
Which of the following is not a DNA sequence? a. TAG b. AUGAUUCT d. AAAAAAAAAA e. CGG