Answered: Which of the following enzymes adds…

Name: Which of the following enzymes adds methyl groups to the guanine on 5
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the following enzymes adds methyl groups to the guanine on 5' end of thepre-MRNA?Methyl transferaseDemethylaseMethylaseAll of the above

Science

Biology

Which of the following enzymes adds methyl groups to the guanine on 5' end of the pre-MRNA? Methyl transferase Demethylase Methylase All of the above

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 8TYU: Which of the following is/are typically removed from pre-mRNA during nuclear processing in...

See similar textbooks

Similar questions

Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA sequence that would be produced? TUTUCGUGUCTU AUAUCGUGACUA ATATCGTGACTA CGCATGTCAGC None of the above
Which pre-mRNA processing step is important for initiating translation? a. poly-A tail b. RNA editing c. splicing d. 7-methylguanosine cap
Which of the following is not a possible size (in bp) of the mature mRNA? a. 205bp b. 180bp c. 150bp d. 100bp
Which of the following RNA Polymerases in Eukaryotes is responsible for producing pre-mRNA? a. RNA Pol I b. RNA Pol II c. RNA Pol III d. RNA Pol IVe. any of the above
One of the following best describes the cap modification of eukaryotic mRNAa) Modified guanine nucleotide added to the 3’ end of the transcriptb) Modified guanine nucleotide added to the 5’ end of the transcriptc) String of adenine nucleotides added to the 3’ end of the transcriptd) String of adenine nucleotides added to the 5’ end of the transcript
Which of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template? 5′ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3′
In pre-MRNA in eukaryotes, introns are removed by the enzyme a.RNA polymerase b.DNA polymerase c.Ribozyme d.DNA ligase e.All of these are correct
Shown below is the 5' end of an mRNA molecule. What are the first three (N-terminal) amino acids of its protein product? 5'-AUGUGUUGAUGUAUCAGACCUGUC ---
Which of the following types of posttranscriptional modification is for mRNA only? a.splicing b.capping c.methylation d.trimming
Prokaryotic mRNA has some unique features compared to eukaryotic mRNA which of the following would apply only to prokaryotic mRNA and not to eukaryotic mRNA Synthesized in the nucleus Producer by RNA polymerase contains introns polycistronic
GCT GAC ATC CTC CTC mutated DNA sequence mutated mRNA sequence mutated amino acid sequence Above is the mutated DNA sequence for part of the 21 hydroxykase gene. Provide the mutated mRNA and amino acid sequence.
All of the following are needed for capping of eukaryotic mRNA, EXCEPT Question 27 options: Guanylytransferase S-AdoMet RNA 5'-triphosphatase Adenosyl-transferase Methyl-transferase