GCT GAC ATC CTC CTC mutated DNA sequence mutated mRNA sequence mutated amino acid sequence Above is the mutated DNA sequence for part of the 21 hydroxykase gene. Provide the mutated mRNA and amino acid sequence.

GCT GAC ATC CTC CTC mutated DNA sequence mutated mRNA sequence mutated amino acid sequence Above is the mutated DNA sequence for part of the 21 hydroxykase gene. Provide the mutated mRNA and amino acid sequence.

Name: GCTGACATCCTCCTCmutated DNA sequence mutated mRNA sequence muta
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: GCTGACATCCTCCTCmutated DNA sequence mutated mRNA sequence mutated amino acid sequenceAbove is the mutated DNA sequence for part of the 21 hydroxykase gene. Provide the mutated mRNA and amino acid sequence.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
Good afternoon, Guidance with this question would be most appriciated. Thank you for your time. Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point mutation in a gene will result in a different polypeptide sequence?
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon 4 to show missensemutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 4
A Sanger product of the sequencing of a template DNA is presented below. It is the polymorphic peptide sequence of Protein Ser-Gly-Lys-Glu-Gly-Lys-Lys. Determine the sequence of template DNA and the mRNA sequence from this template DNA. Briefly explain.
The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And also the mutation type
37Transposons in eukaryotes are mechanistically different from bacterial transposons. Yesorno 38The tRNA has a ( ) secondary structure. 39A single ( ) can be processed to produce two molecules or more different mRNAs.
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 8
Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________
⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?
From the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded? B.What was the base sequence in the original DNA strand was made? Please answer completely will give rating surely Both questions answers needed