Which of the following events would NOT result in ribosomes stalling on an MRNA during translation? O The MRNA in a given region is very highly folded, and the ribosome stalls because the RNA structure blocks its movement. O The correct tRNA is scarce because it is not transcribed very much in the prevailing conditions. The ribosome stalls while waiting for one of the scarce tRNAS to diffuse into the A site. O the release tactor enters the A site, decodes a stop codon and transfers an oxygen from water to the carboxyl group of the peptidyl- RNA in the P site, causing stalling. O Starvation for amino acids will reduce the amount of amino-acylated (charged) tRNA the ribosome will stall while waiting for a charged tRNA to enter the A site to decode the next codon

Which of the following events would NOT result in ribosomes stalling on an MRNA during translation? O The MRNA in a given region is very highly folded, and the ribosome stalls because the RNA structure blocks its movement. O The correct tRNA is scarce because it is not transcribed very much in the prevailing conditions. The ribosome stalls while waiting for one of the scarce tRNAS to diffuse into the A site. O the release tactor enters the A site, decodes a stop codon and transfers an oxygen from water to the carboxyl group of the peptidyl- RNA in the P site, causing stalling. O Starvation for amino acids will reduce the amount of amino-acylated (charged) tRNA the ribosome will stall while waiting for a charged tRNA to enter the A site to decode the next codon

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 2P: The Events in Transcription Initiation Describe the sequence of events involved in the initiation of...

See similar textbooks

Similar questions

Describe the recognition process by whichthe tRNA for N-formylmethionine interacts with the portion ofmRNA that specifies the start of transcription.
Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien
Following is the sequence of a segment of mRNA: CGA AAA GUU UUU What are the anticodons of the tRNAs that will be used for translating this mRNA segment? Group of answer choices a. CGA, AAA, GUU, and UUU b. ARG, LYS, VAL, and PHE c. GCU, UUU, CAA, and AAA d. Arg-Lys-Val-Phe e. GCT, TTT, CAA, and AAA
Do the following events during bacterial translation occur primarily within the 30S subunit, within the 50S subunit, or at the interface between these two ribosomal subunits? A. mRNA-tRNA recognition B. Peptidyl transfer reaction C. Exit of the polypeptide from the ribosome D. Binding of initiation factors IF1, IF2, and IF3
You are observing the translation process in a eukaryotic cell that has been exposed to an unknown toxin. About halfway through synthesizing the protein, you note that elongation is stalled. Upon closer observation you notice the polypeptide is attached to the tRNA in the A-site, while the P site is occupied by an uncharged tRNA. A possible mechanism that is inhibiting translation is: Question 21 options: eEF-1βγ (beta-gamma) was inhibited from activating eEF-2. Peptidyltransferase activity was inhibited. eEF-2 was inhibited from being activated. eEF-1βγ (beta-gamma) was inhibited from activating eEF-1α (alpha). eEF-1α cannot be released from the aminoacyl-tRNA in the A-site.
The tRNA molecule carries EIF2 and GTP and binds the small ribosomal subunit at the P site in the first steps of translation initiation. tue or false
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
. You have identified a mutation in yeast, a unicellular eukaryote, that prevents the capping of the 5′ end of theRNA transcript. However, much to your surprise, all theenzymes required for capping are normal. You determine that the mutation is, instead, in one of the subunitsof RNA polymerase II. Which subunit is mutant, andhow does this mutation result in failure to add a cap toyeast RNA?
Usually found in prokaryotes, regulatory sequences lying adjacent to the DNA being transcribed are composed of a promoter located next to a(n) ____ that interacts and is controlled by regulatory protein. TATA box rho binding domain RNA polymerase holoenzyme operator
In vitro translation systems have been developed inwhich specific RNA molecules can be added to a testtube containing a bacterial cell extract that includes allthe components needed for translation (ribosomes,tRNAs, amino acids). If a radioactively labeled aminoacid is included, any protein translated from that RNAcan be detected and displayed on a gel. If a eukaryoticmRNA is added to the test tube, would radioactive protein be produced? Explain.
Scientists have exploited the siRNA pathway toperform a technique called RNA interference—ameans to knock down the expression of a specificgene without having to make mutations in it. Theidea is to introduce dsRNA corresponding to thetarget gene into an organism; the dsRNA is thenprocessed into an siRNA that leads to the degradation of the target gene’s mRNA. One clever methodfor delivery of the dsRNA to some organisms (thenematode C. elegans, for example) is to feed thembacteria transformed with a recombinant plasmidthat expresses dsRNA.a. Draw a gene construct that, when expressed from aplasmid in bacteria, could be used to knock downby RNA interference the expression of gene X ofC. elegans.b. How can you test if gene X expression is obliterated in worms that have eaten the bacteria transformed with a plasmid containing your construct?c. Do you think that only gene X expression will beaffected in these worms? Explain.
Humans have ~20,000 genes which create > 100,000proteins used by our cells. What process enables thisevolutionary success story?A. Coupling of transcription and translation to producemature mRNAsB. Addition of the 5' cap and 3' poly-A tail to produce maturemRNAsC. Alternative expression of introns to produce maturemRNAsD. Alternative splicing of pre-mRNAs to produce maturemRNAs