an anticodon on one end and a site for an amino acid to attach on the other end. There is base complementarity (A pairs with U and G pairs with C) between an mRNA codon and tRNA anticodon. If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the opposite end of the tRNA molecule? a. UUU and UUC b. AAA and AAG c. AGA and AGU d. UCU and UCA

Q: UAA is a stop codon. Why does the UAA sequence in the segment of mRNA…

A: Stop codons do not specify any amino acid. When ribosome faces any stop codon, it stalls. When the…

Q: Which of the following statements are true? O Each stop codon also codes for an amino acid O Each…

A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…

Q: Which of the following is true regarding the tRNA structure?   The anticodon is found at the 5′ end…

A: The anticodon is found at the 51 end of the tRNA molecule. An amino acid binds to 31  end of the…

Q: For each amino acid incorporated into a polypeptide the cell has to invest three high-energy…

A: TRANSLATION It  is the process by which a protein is synthesized from the information contained in a…

Q: Several different nucleic acids are involved in the process of getting a protein produced from a…

A: Sense strand is that strand of DNA double helix which has the translatable protein code in the 5'-3'…

Q: In cells, proteins are synthesized from a gene sequence via the process of transcription and…

A: In prokaryotes cell organelles are absent. The genomic DNA of prokaryotes is found in the cytoplasm.…

Q: An mRNA encodes a polypeptide that is 312 amino acids in length. The fifty-third codon in this…

A: The messenger ribonucleic acid (mRNA) is a molecule that synthesizes commands to produce products…

Q: A tRNA with the attached amino acid is referred to as “charged.” The amino acid is added at which…

A: The tRNA is the transfer RNA that transfer the amino acids to the growing polypeptide chain.  The…

Q: The sequence below is an mRNA strand that is in the cytoplasm ready to translated by a ribosome. If…

A: Translation is the process of formation of a protein chain from a RNA chain. Translation requires an…

Q: If a tRNA has an anticodon with the sequence 5′-CAG-3′, which amino acid does it carry? a. Aspartic…

A: An anticodon is the nitrogen base triplet present in the transfer RNA molecule and the codon is the…

Q: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

A: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

Q: If the codon in the mRNA is 5' AUG', then the anticodon of the initiator tRNA is 5' CAT3' O 3' UAC5'…

A: CODON-  It is a unit of three nucleotides that forms a genetic code in a DNA/RNA.

Q: Which of the following is always true of ribosomes? The small ribosomal subunit is composed of only…

A: Ribosomes are macromolecular machines that perform biological protein synthesis and are found in all…

Q: The amino acids listed above that are coded by the mRNA codon

A: Protein synthesis is a major process inside our body .Our body has complex system for protein…

Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…

A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…

Q: If given the following coding strand of DNA, what is the mRNA?  What tRNA will be present?  (hint -…

A: DNA is a hereditary molecule made up of two polynucleotide chains lies in the nuclues of all…

Q: Which of the following statements about the genetic code are true and which are false? Correct each…

A: Genetic code is the sequence of nucleotides in the mRNA that determines the sequence of amino acids.…

Q: Each time a new tRNA is added to the A site, it adds its amino acid to the bottom of the growing…

A: The description in the question is related to Protein synthesis or translation process which occurs…

Q: Which of the following base pairings are allowed between an anticodon and the 3' base of a codon,…

A: According to wobble hypothesis, the third nucleotide of anticodon is a wobble and can base pair with…

Q: codons is the term used to describe the genetic code because the rules that relate the nucleotide…

A: A codon is a three-nucleotide sequence of DNA or RNA that corresponds to a specific amino acid or…

Q: Which of the following is true regarding the tRNA structure?   The anticodon is found at the 5′ end…

A: Answers :  The anticodon is found at the 5′ end of the tRNA molecule.  Anticodon is found in the…

Q: Which of the following nucleotide triplets best represents a codon?

A: Introduction:- A codon is a triplet of bases (or nucleotides) in the DNA coding for one amino acid.…

Q: The tRNA for Phe binds to the mRNA codon UUU. You mutate the anticodon of the Phe-tRNA from AAA to…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: Which of the following statements is false about the structure of TRNA? O Because of hydrogen bonds,…

A: RNA is ribonucleic acid which is single stranded .It is of three types :- A ) mRNA B ) tRNA C ) rRNA

Q: Which of the following statements regarding the genetic code is false? The genetic code is…

A: Genetic code is used for ways in which the four bases of DNA- - the A, C, G, and Ts- - are hung…

Q: A sequence of mRNA is mutated such that there is no "start" codon. Which of the following is a…

A: The ribosomal binding on the mRNA requires the presence of Shine Dalgarno or kozak sequence upstream…

Q: Which of the following is true for the tRNA of eukaryote cells? tRNA is a) made of DNA and protein,…

A: In nucleus the tRNAs are prepared and released to the cytoplasm. In there they attached to amino…

Q: There are 61 mRNA codons that specify an amino acid, but only 45 tRNAs.  This is best explained by…

A: Answer: Introduction: The mRNA codons are read while translation, starting with a start codon and…

Q: In the normal course of events within protein synthesis, which of the following is part of, or cal…

A: The tRNA molecule has a distinctive folded structure with three hairpin loops that form the shape of…

Q: If a TRNA anticodon was GUG, which amino acid would the tRNA carry? Below is a partial genetic code…

A: TRANSLATION It is the process of formation of a polypeptide chain by joining of various amino acids.…

Q: The translation of an mRNA begins with the codon AUG, and an initiator tRNA is required to start…

A: The ribosome starts translation, the assembly of a protein out of amino acids, when it encounters…

Q: Which statement BEST DESCRIBES the tRNA structure? A. Amino acids bind to the 5′ end of the tRNA…

A: Introduction: A significant class of ribonucleic acids is called transfer RNA (tRNA). During protein…

Q: A peptide has the sequence NH 2-phe-pro-lys-gly-phe-pro-COOH. Which of the following sequences in…

A: Correct answer :-  5' TTT-CCC-AAA-GGG-TTT-CCC  ( option B is correct.)

Q: UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?

A: RNA- It  stand for the ribonucleic acid.  is a nucleic acid present in all living cells and in some…

Q: A series of tRNAs have the following anticodons. give all possible codons with which each tRNA can…

A: Anticodon relatable term with another term which is codon. A codon is a three-nucleotide stretch of…

Q: The codon and anticodon are base-paired together during the process of translation. Which of the…

A: The central dogma of molecular biology involves the transfer of information from DNA to proteins…

Q: Which of the following statements about tRNA molecules is TRUE? Multiple Choice TRNA assumes a…

A: A transfer RNA or tRNA is a special kind of RNA molecule. Work of it is to match an mRNA codon…

Q: When the ribosome reaches a nonsense codon, which of the following occurs?     a methionine is…

A: Ribosomes are translational machinery utilized during the synthesis of proteins. It is a complex of…

Q: Which statement BEST DESCRIBES the tRNA structure? Chooose from the options below. Amino acids bind…

A: Introduction :- The three hairpin loops that make up the tRNA molecule's characteristic folded…

Q: A mutation in DNA generates a aUGA stop codon in the middle of the mRNA coding for a particular…

A: A gene is a nucleotide sequence in the genome that codes for a functional molecule. The gene's DNA…

Q: A tRNA's anticodon binds to the RNA sequence: 5'-CUA-3'. What is the sequence of the tRNA's…

A: RNA is Ribonucleic acid which is formed from DNA via the process of transcription . It takes place…

Q: In this picture, a tRNA is already bound to the initiator codon at the start of the mRNA strand. The…

A: The central dogma states that the genetic information will flow from DNA to RNA and then to protein,…

Q: help

A: Translation is the process for synthesizing the protein from mRNA by the action of ribosomes. It…

Q: If the amino acid serine attaches to a tRNA, which of the following anticodons could be at the…

A: tRNA  tRNA or transfer RNA is a Kind of RNA molecule that decode the code of mRNA and brings amino…

Q: Below is the sequence from the 3' end of an mRNA. S'..CCGUUACCAGGCCUCAUUAUUGGUAACGGAAAAAAAAAAAAAA-3'…

A: The eukaryotic premature mRNA is synthesized without the poly-A tail. The poly-A tail is added at…

Q: A particular triplet of bases in the anticodon strand of the tRNA is 5' - AGU - 3'. A.  The…

A: The single-stranded RNA is called messenger RNA.  The ribosomes read an mRNA when making proteins.…

Q: Match each term with the most appropriate description. ​sites for polypeptide assembly   ​binds to…

A: All cells have the translation process resides within a specialized organelle which is known as the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.