Which of the following is not a characteristic of water due to hydrogen bonding? Solvent Adhesion Cohesion Adenosine

Q: In cats, fur color is a sex-linked trait, where black fur is dominant over yellow fur. If a calico f...

A: Genetics is the discipline of science concerned with the study of genes and their transmission from ...

Q: What are the two key concepts for this section?Define freshwater. Explain why access to water is ahe...

A: Water is a vital resource that is essential for human survival, health, and economy. Access to clean...

Q: In a population of geese, the narrow-sense heritability for wing span is shown to be 0.5. If the phe...

A: The formula that can be used to calculate narrow-sense heritability is equal to: h2=VAVP Here h2  eq...

Q: How does the body restore normal blood calcium levels during a state of hypocalcemia (low blood calc...

A: The body maintains a tight grip on the amount of calcium circulating in the blood at all times. This...

Q: Direction: Determine the principal action of the hormones in Column A. Identify its major action (Co...

A: The above mentioned hormones play an important role in the reproductive system of males and females....

Q: A.) Deletion mutation is a loss of a single base by damage. B.) Point mutation is when a nucleotide ...

A: "Since you have asked multiple question, we will solve the first question for you. If you want any s...

Q: How do we know that the lac repressor is a protein?

A: Lac repressor protein is encoded by the lac I gene.

Q: WORD FILL INS a) All chordates as embryos have the start of gills- what are these called? ____ pouch...

A: Vertebrates, tunicates, and lancelets are all members of the Chordates (Chordata) family of animals....

Q: Most of the carbon dioxide that plants use for photosynthesis comes from______ . a. glucose c. rainw...

A: photosynthesis is the process that plants use to turn carbon dioxide and water into glucose and oxyg...

Q: What type of molecule is shown here? Give its biological importance? ÇH2OH но OH test question 3.png...

A: It is the structure of glucose molecule.    It is present in pyran ring form.  So it is called gluco...

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...

A: The malting temperature (Tm) of the DNA  is the temperature at which at least 50% of dsDNA is conver...

Q: Explain your answer. Below is a pedigree showing the inheritance of colorblindness in Akoto family. ...

A: Colorblindness is a X-linked recessive disorder. X-linked recessive disorders are those which are pa...

Q: Compare the cyclic and noncyclic light-dependent reactions

A: Introduction: As the anabolic reaction that transforms solar light energy into cellular chemical ene...

Q: Why didn't photosynthesis progress earlier in the Archaean?

A: Photosynthesis is the cellular process by which plant use sunlight for sun, water from soil, and Co2...

Q: Explain how fog forms off the San Francisco coast. For a complete answer, you need to use the follow...

A: The term fog is associated with the cloud that is comparatively closed to ground than to the sky. Fo...

Q: Explain which type of isolating mechanism this would be once you determine the barrier type?

A: Isolating mechanisms are the processes by which groups of organisms become isolated long enough to g...

Q: ystic fibrosis (CF) is an autosomal recessive condition triggered by the overproduction of sticky mu...

A: Suppose the alleles affecting CFTR protein formation are AA, aa being homozygous recessive and hence...

Q: 3. How can one use a pedigree chart to hypothesise how a certain condition is transmitted? Can a ped...

A: Pedigree shows relationship between family members and indicates which individual have certain genet...

Q: Match each item in column A with an item in column B. Write the letter of the correct answer on the ...

A: Humans are either left-brained or right-brained, according to this notion, implying that one half of...

Q: Sex-linked inheritance

A: Glucose-6-phosphate dehydrogenase deficiency/G6PDD (g) is an X-linked recessive condition.  Fragile ...

Q: You want to breed an apple tree that produced apples with no seeds, yet keeps the specific apples of...

A: Introduction:- An autopolyploid has an additional set of chromosomes that are identical to the paren...

Q: Why do you need to lest the null hypothesis instead of just proving an alternatine bypothesis?

A: A null hypothesis is a claim that no link exists between two variables. An alternate hypothesis is a...

Q: what is an enzyme

A: Proteins are the building blocks of the body. It plays an essential role in the body. Proteins are m...

Q: What are the various names of articulations based on movement?

A: Articulation is a joint between bones or cartilage in the skeleton of an animal.   Joints or articul...

Q: Standard of precautions provide guidelines for the purpose of; I. Eliminating the source of infectio...

A: Standard of precautions provide guidelines to prevent spreading of disease transmission (patient to ...

Q: what advantages do regulatory systems provide to the organisms?

A: Introduction :- The neurological system and the endocrine system work in tandem to control and coord...

Q: Explain what might happen in the food web if snakes were removed from the ecosystem Snake Frog Rabbi...

A: An ecosystem is defined as a structural and functional unit of ecology where plants, animals, and ot...

Q: Why is cholesterol important in the human body?

A: Sterols are substances that lack fatty acids yet possess fat-like characteristics. Each sterol is ma...

Q: A homozygnous Dominant brown mouse is crossed with a heterozynous Brown mouse(tan is ressesive color...

A: A gene is a piece of DNA that contains the instructions for a specific feature or attribute. Heteroz...

Q: What would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5' ACCT...

A: Transcription: The process of formation of RNA from the DNA by  action of DNA dependant RNA polymera...

Q: Describe what happens when a pigment that is part of a lightharvesting complex absorbs light.

A: Photosynthesis is the conversion of light energy into chemical energy by phototrophs, which is then ...

Q: D. 6.The B blood-type allele probably originated in Asia and subsequently spread to Europe and other...

A: Aim:  to know the concept about biological evolution, natural selection, genetic drift, analogy, and...

Q: and have no 6. Bacteria do not have a a. nucleus, cell membrane b. nucleus, organelles c. cell membr...

A: Answer 6- b. Nucleus, organelle Bacteria do not have a nucleus and have no organelle in them( except...

Q: For water to vaporize O energy must be supplied. both energy must be supplied and hydrogen bonds bro...

A: Introduction: The process through which a liquid state changes into a vapour state is known as vapor...

Q: B. Encircle Monophyletic groups that can be found in this tree. Angus cattle White-tailed deer Blue ...

A: Phylogenetic tree is a diagrammatic representation which evaluates how the taxons are closed related...

Q: an insect population lives on trees. over time, more trees with light colored bark grown in their ha...

A: Introduction:- Camouflage (noun) is defined as the act of concealing one's physical appearance. Camo...

Q: Why did it take so long for scientists to figure out that infections are caused by bacteria? What we...

A: Bacteria is prokaryotic microorganism. 

Q: Which of the following effects is produced by the high surface tension of water?   Group of answer...

A: Due to the cohesive nature of the water molecules, surface tension can be defined as a feature of a ...

Q: 1. How easy was it to predict the possible composition of the 1st filial and 2nd filial generations ...

A: The question is in past tense, as if some type of mono,di or tri-hybrid cross was given as a part of...

Q: How do we know that the trp operon is a repressible controlsystem, in contrast to the lac operon, wh...

A: Introduction The process by which the information contained in a gene is used to drive the assembly ...

Q: Viruses are capable of infecting bacteria by injecting their DNA into the bacterial cells. This was ...

A:     Viruses are capable of infecting bacteria by inserting their DNA into the bacterial cell. This w...

Q: If RR stands for red, RR' stands for roan and R'R' stands for white; as well as B stands for bucking...

A: The Punnett square can be used to determine the genotypes in a cross or mating experiment.

Q: In flies, long wings (W) are dominant to short wings (w). Two homozygous recessive flies are crossed...

A: Given: In flies, long wings(W) are dominant to short wings(w). Dominant traits are always expressed ...

Q: A transport protein requires ATP to pump sodium ions across a membrane. This is a case of_______ . a...

A: The act or the means by which a molecule or ion is moved across the cell membrane or via the bloodst...

Q: Photosynthesis runs on the energy of_______ . a. light c. O2 b. hydrogen ions d. CO2

A: Introduction Plants need the green pigment chlorophyll to perform photosynthesis, which produces oxy...

Q: 8:25 Screenshot_2021120 What I Can Do Activity 6. What is your stand? Directions. Below are some of ...

A: A genetically modified organism (GMO) is any organism whose genetic material has been altered using ...

Q: 6. Create a Venn Diagram to show the relatedness of these organisms. Start with the trait that is sh...

A: Answer :: Step  1 of 3 ::   Cladistic is a diagrammatic representation which determines evolutionary...

Q: Provide a proof that a different phenotype can be produced from the same genotype. What are the pos...

A: The collection of genes that make up a person's genotype is referred to as that person's genotype. I...

Q: 2. Brown eyes are dominant over blue eyes in humans. Having a peaked hairline is dominant over havin...

A: Homozygous - This is a genetic state in which a person inherits the same alleles from both parents f...

Q: A trait exhibits 100% concordance in both monozygotic and dizygotic twins. What conclusion can you d...

A: Answer- both genetic and environment factors are important