Which of the following occurs during the carbon-fixation reactions of photosynthesis? A. Water is converted into hydrogen and water. B. CO2 is converted into sugars. C. Chlorophyll acts as an enzyme. D. Nothing occurs; the plant rests in the dark. E. Glucose and oxygen are reduced to CO2 and water.

Which of the following occurs during the carbon-fixation reactions of photosynthesis? A. Water is converted into hydrogen and water. B. CO2 is converted into sugars. C. Chlorophyll acts as an enzyme. D. Nothing occurs; the plant rests in the dark. E. Glucose and oxygen are reduced to CO2 and water.

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter6: Where It Starts-photosynthesis

Section: Chapter Questions

Problem 14SA: In C3 plants, _______ makes sugar production inefficient when stomata close on hot, dry days. a....

See similar textbooks

Related questions

Q: How can 5-HT2a activation be linked to dream-like experiences and hallucinations, but serotonin is…

A: 5- HT2a is a receptor antagonist it results in significant but differential regulation of mRNA…

Q: The following sequence is a double stranded DNA.…

A: The promoter region is a crucial segment of DNA located upstream (in the 5' direction) of a gene…

Q: -pecies 1 is described as 2n = 8 and has chromosome composition BBDDEEHH. pecies 2 is described as…

A: Trisomy is a condition where the organisms contain an extra copy of one of the chromosomes. In the…

Q: 15 These are the weakest bonds of all and are sensitive to pH as well as changes in temperature. a.…

A: There are different types of bonds or biological interactions found in living systems. These bonds…

Q: Look at the pedigree below. If individual 3 marries a carrier for cystic fibrosis, what would be the…

A: A pedigree is a representation of the inheritance of a trait or character or disease from one…

Q: an F2 generation. If there are a total of 200 F2 flies, how many of the F2 females are expected to…

A: A character is autosomal linked when the gene is present on autosomes and the character is X linked…

Q: words, describe the differences you see for each organism grown at 30 C or 37 C (i.e., amount of…

A: Microorganism have their own optimal growth at an optimum tempearture and pH. In these pictures, we…

Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…

A: Fungi are a group of microorganisms that belong to the kingdom Fungi. They are eukaryotic organisms,…

Q: The limbic system utilizes specific pathways in the brain to prevent sensory overload and help with…

A: The limbic system and the reticular activating system (RAS) are two distinct components of the human…

Q: Part A: To which other species of storm-petrel is H. matsudairae, the cold-season breeder on Japan,…

A: Phylogenetic trees are evolutionary diagrams that depict the relationship between organisms of…

Q: Glycolysis occurs in which part of the cell? in the cytoplasm in the matrix of the…

A: Cellular respiration is a metabolic process in which organic food material is broken down to…

Q: Classify each statement as describing DNA replication in prokaryotes, eukaryotes, both, or neither.…

A: DNA replication is a process in which their is synthesis of daughter DNA takes place from parental…

Q: 3.0 g Beef extract 10.0 g Pancreatic digest of casein 5.0 g NaCl Agar (low percentage to allow for…

A: The provided medium comprises several key components, as follows:Beef extract: 3.0 gPancreatic…

Q: Part A If E. coli bacteria are placed in an environment that contains both glucose and lactose, the…

A: When glucose concentrations are low, E. coli can use other sugars as fuel. The c AMP-CAP protein…

Q: Classify the examples as pre‑zygotic or post‑zygotic barriers.

A: Prezygotic barriers prevent mating or fertilization, while postzygotic barriers prevent the…

Q: Cockroaches from the dormitories at Texas A&M University usually weigh about 1 gram. However, about…

A: This is an example of polygenic inheritance where several genes are involved to give rise to a…

Q: 3) A 28 year old graduate student has a diagnosed history of bipolar disorder, characterized by his…

A: The situation displayed includes a graduate student with bipolar disorder, a condition characterized…

Q: Based on the video, describe at least two lines of evidence that can be used to evaluate whether…

A: The classification of plesiadapiformes like Purgatorius as primates is a topic of ongoing debate in…

Q: 1. Draw the label cardiac muscle tissue as you observed it at medium magnification. 2. Draw and…

A: Muscles contract to contribute to both gross and fine movements, enabling actions such as walking,…

Q: 27) If the sequence TCGTA was used as a template in DNA replication, what would the sequence of…

A: Chromosome is a thread-like elongated structure that contains numerous genes on it. Genes act as…

Q: Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance…

A: Lipid metabolism is the process by which the body breaks down and synthesizes lipids. Lipids are a…

Q: Which of the following is NOT a deuterostome? O Shark O Spider O Sea urchin Sea turtle

A: In the diverse world of animals, there are distinct developmental patterns that classify them into…

Q: Match the identity and description of the indicated parts of the long bone in the picture. A B C- D…

A: Bones are the tissue that makes up an important component of the skeletal system. Bones provide…

Q: In pea plants yellow seed color, (GG) and round seed shape (WW) seeds are dominant traits, while…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Yeast cells grew from 19 to 54 kg dry cells m-3 in 7 hours. During this period 81 g of glycerol was…

A: In a bioprocess involving yeast cells, it is crucial to assess their growth and yield in relation to…

Q: OXWTMA OU G K Т М А Q GKWTMAQC ++ + - ++ - - - - - + - + - + - - + - + - + + + - + + A cistron is…

A: In a complementation chart a group will contain similar mutations that failed to complement one…

Q: In corn (Zea mays), the wild type trait is for kernels to be round; some kernels are shrunken (S),…

A: In Zea Mays the shape of kernels is determined by various genes. Usually two varieties are observed,…

Q: How are prosimians different from the group consisting of American monkeys, African-Eurasian…

A: The discussion on this subject examines the differences between prosimians, a suborder of primates,…

Q: Identify all pathological features and establish correct diagnoses of the disease

A: Therapeutic image investigation is a critical part of diagnosing a variety of ailments and…

Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…

A: A pathogen is a microorganism, such as a bacterium, virus, or fungus, that can cause diseases in…

Q: Which of the following is NOT true about metabolic pathways in general? They can be anabolic or…

A: In the complex world of cellular metabolism, various biochemical pathways play crucial roles in…

Q: Describe how NADH transfers electrons to electron transport proteins of the ETS and ultimately to…

A: According to the guidelines of Bartleby,"Since you have posted multiple questions, we will provide…

Q: bottleneck effect gene flow founder effect sexual selection 1. As habitats change, populations of…

A: Evolution is a natural process occurring continuously in nature, It involves adaptation of the…

Q: What is the lactate threshold?

A: A greater lactate threshold allows an endurance exercise to be continued without the accumulation of…

Q: Why is the precise timing of recombination events critical during B and T cell development?.

A: B and T cell development is the complex biological process through which precursor cells mature into…

Q: See image

A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: Select all CORRECT answer choices regarding the following question: "Which of the following are…

A: Bacteria are prokaryotic, single-celled, heterotrophic organisms. As they are heterotrophic…

Q: Why is it that for table no 2 the tan offspring is Aabb and the black is aabb and why are we have…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance…

A: Fermentation is the process in which a microorganisms converts carbohydrates like starch or sugar…

Q: Identify the following: Description: Embryonic origin : Function : Location in the body: 1. Simple…

A: In the study of anatomy and biology, various types of epithelial tissues play critical roles in the…

Q: Why is it necessary to sterilize the loop between streaks when streaking for single colonies?

A: Streaking is a technique used to isolate a pure strain from a single species of microorganism, often…

Q: What are three traits (besides a post-orbital bar) that are DERIVED traits when COMPARING primates…

A: Ancestral primate traits refer to the fundamental characteristics and features that are shared by…

Q: Which of the following statements about the protein quality control system in the endoplasmic…

A: Endoplasmic reticulum is present in the cytoplasm, is a continuous membrane system consisting of…

Q: C. What genotypes lead to the phenotypes of the F2? What phenomenon is occurring in the F2…

A: Saccharomyces cerevisiae, bakers yeast is an model unicellular organism for genetic experiments. It…

Q: C6H12O6

A: C6H12O6:This is a glucose molecule.It is a vital carbohydrate and primary source of energy for…

Q: what is the flow rate of all kinds of gases that should be receiving to the patient ?

A: A gas flow rate is the amount of gas that travels through a specific spot in a specific amount of…

Q: QUESTION 5 Which of the following is (are) problematic when the goal is to construct phylogenies…

A: Polyphyletic taxa include groups of organisms that share a common ancestor but also include some…

Q: 100 implants 4,500 hrs of testing the implants 4 implants failed halfway through failure rate is…

A: The method of testing implants could be a critical viewpoint in ensuring their reliability and…

Q: Brown induration of the lungs H&E staining, Perls reaction Mark the corresponding elements in the…

A: The term "induration" refers to the hardening of the lungs. "Hemosiderin" is an iron-containing…

Q: Match the label to the correct location on the corresponding image. Lower pitch Endolymph Oval…

A: The tympanic membrane is present between the outer ear and the middle ear. The basilar membrane…

Concept explainers

Photosynthesis

Plants have a capacity that we humans can only imagine— the ability to produce food from sunlight. Sure, we can prepare some dishes that we can savor on, but it become possible because of the plants (as they serve as a producers of all the raw materials required). Photosynthesis is the method of assembling carbohydrates with the aid of sunlight.

Question

Which of the following occurs during the carbon-fixation reactions of photosynthesis?

A. Water is converted into hydrogen and water.

B. CO2 is converted into sugars.

C. Chlorophyll acts as an enzyme.

D. Nothing occurs; the plant rests in the dark.

E. Glucose and oxygen are reduced to CO2 and water.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Carbon-fixation reactions of photosynthesis

VIEW

Step 3: Explanation of incorrect options

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

In C3 plants, _______ makes sugar production inefficient when stomata close on hot, dry days. a. photosynthesis c. photorespiration b. photolysis d. carbon fixation
From a plant's perspective, the main purpose of photosynthesis is to Group of answer choices a)to produce sugars and oxygen for heterotrophs. b)plants are not cognitive organisms and therefore we have no idea what the "purpose" of photosynthesis is for the plant. c)to produce enough O2 gas for the plant to survive through the night. d)make sugars, such as glucose, to use for building cell walls and for energy needed by the plant.
The role of photosystem 1 and photosystem 2 in the process of photosynthesis is to a. absorb sunlight and distribute the energy as heat b. absorb sunlight and transfer the energy to electrons c. form ATP as hydrogen ions cross the thylakoid membrane d. transfer electrons to form NADPH
Suppose we set up a system in a lab where plants are automatically injected with all the glucose they need to survive. What part of photosynthesis would the plants no longer need to perform? Group of answer choices a)ETC 1 b)the entire dark reaction c)the entire light reaction d)P700 e)all of it
In the photosynthetic formation of ATP, the enzyme ATP synthase couples the synthesis of ATP to: A. the diffusion of protons B. the reduction of NADP+ C. the excitation of chlorophyll D. the reduction of chlorophyll E. CO2 fixation
Using the graph comparing photosynthetic rate and absorption of different wavelengths of light, what can be concluded? a) The photosynthesis rate at 550 nm is the highest b) Chlorophyll a absorbs wavelengths at both ends of the spectrum c) Chlorophyll b is associated with the greatest rate of photosynthesis. d) Carotenoids absorb the narrowest range of wavelengths of light
The figure below shows the concentration of glucose for a 24-hour period on both the process of photosynthesis (blue) and cellular respiration (red dashed lines). What explains the increase of respiration rate during the day? a. Enzymes are active during the day. b. Glucose production has increased due to photosynthesis. c. More energy is required to transport water and phloem sap and to dissipate heat. d. All of the above.
When oxygen gas is released as a result of photosynthesis, it is a direct byproduct of what process? a. splitting of water molecules b. the electron transfer system in the photosystems c. chemiosmosis d. reducing of NADP+
________ reactions of photosynthesis generate NADPH and ATP to carry solar energy. a. The light-independent b. The light-dependent c. Both the light-dependent and -independent
The main purpose of the light-independent reactions is to ________. a. convert solar energy to chemical energy b. convert solar energy to ATP for short-term energy use c. build carbohydrates for long-term energy storage
Photosynthesis generally takes place in which parts of the plant? A. Leaf and other chloroplast bearing parts B. stem and leaf C. Roots and chloroplast bearing parts D. Bark and leaf
Which of the following changes would decrease ATP production in the light-dependent reactions of photosynthesis? a. decreasing the pH of the thylakoid lumen b. decreasing the pH of the chloroplast stroma c. increasing the concentration of NADP+ in the chloroplast stroma d. making the thylakoid membrane freely permeable to protons by adding a proton channel e. two of the above would decrease ATP production