Some events that take place in proteins synthesis are shown below: A. An enzyme reads the gene surface B. A transcription factor bonds to a promoter site C. An mRNA molecule is produced D. The transcript leaves the nucleus E. An MRNA polymerase attaches to the template strand Which if the following shows the correct sequence? O ACEDB ОЕВАСD ВАСЕ D ЕАCAD О САВЕD АВСЕD ВАED C ВЕАСD
Q: The function of the genetic code is toa. promote transcription.b. specify the amino acids within a…
A: Genetics can be defined as the branch of biology which is concerned with the study of genes, genetic…
Q: The function of the genetic code is toa. promote transcription.b. specify the amino acids within a…
A: Genetic code is a set of rules used by living organism’s cells in the process of translation that is…
Q: If a mutation deletes the start codon in a eukrayotic gene, which of the following most accurately…
A: The start codon is a three-nucleotide long sequence in a gene that is responsible for the initiation…
Q: Match Column A with Column B. |Intron is removed from the MRNA transcript A 1st event v MRNA is…
A: Transcription is the mechanism by which mRNA is produced from template DNA in molecular biology. As…
Q: A). What is the amino acid sequence of the polypeptide produced from a eukaryotic gene that has the…
A: Transcription The process on making mRNA from DNA which further get translated into polypeptide…
Q: The Kozak rules determine a. the choice of the start codon in complex eukaryotes. b. the choice of…
A: Eukaryotic mRNA (messenger ribonucleic acid) can have multiple AUG (start codon) sequences on it.…
Q: mutation
A: Answer: Mutations in the promoter region resulted in a change in DNA binding pattern of the AP-2…
Q: During elongation (in transcription), RNA polymerase has three prominent channels, or grooves. These…
A: Gene expression is the process by which information from a gene is used in the synthesis of a…
Q: For transcription to occur, the promotor region of DNA will a) Make a DNA copy of the DNA template…
A: RNA polymerase is the key central enzyme that regulates the transcription process. Prokaryotes need…
Q: Number the following steps of protein synthesis in order in which they occur, starting with 1 and…
A: Translation - it the process in which proteins are formed from ribosomes particularly,from mRNA…
Q: Which of the following base sequences is used during transcription? a. Promoter and terminator b.…
A: Transcription is a template of DNA strand that is used in the profitable synthesis of messenger RNA…
Q: The portion of the mRNA that is removed during splicing is (a) an inverted repeat (b) the promoter…
A: The protein synthesis is a process which involves two steps transcription and translation .…
Q: Number the following steps of protein synthesis in the order in which they occur, starting with 1…
A: Central dogma involves transcribing the information from DNA to RNA and from RNA to protein…
Q: Which of the following is not a function of the 5’ cap and 3’ poly-A tail of a mature eukaryotic…
A: Introduction: RNA polymerase is an enzyme that copies DNA. The RNA polymerase binds to the promoter…
Q: The portion of the mRNA transcript that gets removed duringRNA processing is thea. exons.b.…
A: Ans: RNA processing: The post transcription processing in eukaryotes is referred to as RNA…
Q: Which of the following is an example of a transcription factor? A) gene B) a repressor C) a…
A: A transcription factor (TF) (or sequence-specific DNA-binding factor) is a protein in molecular…
Q: For each of the 3 processes below, ... .Fill in list of terms needed (choose terms from the "List of…
A: Transcription is a process of formation of transcript or RNA from DNA by the process of…
Q: To facilitate movement of mRNA from the nucleus into the cytoplasm, what is added to the 3’ end of…
A: According to the question, we have to explain to facilitate the movement of mRNA from the nucleus…
Q: What is the genetic code? a. The relationship between a three-base codon sequence and an amino acid…
A: Translation is the process of conversion of an mRNA (messenger RNA) molecule into a functional…
Q: The ribosome is needed for translation of mRNA (a) because it has the enzyme that forms peptide…
A: Ribosomes are found on Rough endoplasmic reticulum of a cell (in eukaryotes) , which actively…
Q: Each of the following statements about protein synthesis is false.Correct each to make a true…
A: Nucleotides are the monomers of nucleic acids, DNA and RNA. A nucleotide is composed of a…
Q: The sequence of bases in a sample of MRNA was found to be: GGU,AAU,CCU,UU0,GUU,ACU,CAU,UGU a Deduce…
A: mRNA is messenger RNA which is produced as a result of transcription from DNA. RNA polymerase…
Q: The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome:…
A:
Q: Ribosomes that are translating a mRNA, would release that mRNA when they reach a) an operator b) a…
A: Introduction :- Ribosomes have two primary functions: message decoding and peptide bond synthesis.…
Q: Which of the following functions is NOT typically attributed to small nuclear RNA (SNRNA)? A)…
A: Ribonucleic acid is a complex of the high molecular weight molecule that participates in cellular…
Q: Which two sequences shown in the diagram are NOT directly transcribed from the template strand of…
A: ANSWER - in this figure the following sequences are not directly transcribed from the template…
Q: Transcription is initiated when: a. initiation factors assemble ribosomal subunits, mRNA, and…
A: Transcription: It is Initial copying of the DNA strand with RNA Polymerase to make RNA. Before the…
Q: a. Write the sequence of the MRNA synthesized from the upper strand. b. Indicate the 5'and 3'ends of…
A: Answer : a. Sequence of mRNA synthesized from the upper stand - 5' AUGCCAUUUUGA 3' b. 5' and 3' ends…
Q: A begins as a short segment of the double helix is unwound by A.The RNA polymerase binds to the…
A: Gene expression Gene expression is the process by which a gene is inside for its specific product.…
Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…
A: Transcription is the process in which RNA is synthesized from DNA.
Q: Which of the following is LEAST likely to be transcribed into RNA? a) introns O b) promoters &…
A: Transcription is the process of conversion of DNA molecule into messenger RNA.
Q: The formation of peptide bonds between amino acids occurs _____. a. during transcription b.…
A: Translation involves “decoding” a messenger RNA (mRNA) and using its information to build a…
Q: The following segment of DNA codes for a protein. The uppercase letters represent exons. The…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: The amino acid pool used in translation is found in: a. the cytosol b. in the Golgi apparatus c. in…
A: The amino acid pool used in translation.
Q: Below is a picture of multiple mRNA molecules being transcribed simultaneously from the same…
A: mRNA transcription and translation occurs at same time in prokaryotes(polycistronic) while in…
Q: double-stranded helix
A: After mRNA synthesis there are post transcriptional processes which converts the heterogenous…
Q: What process is the P site in a ribosome most closely associated with? a. Binds the tRNA…
A: Ribosomes are complex cell organelles, which are composed of ribonucleic acid (RNA) and ribosomal…
Q: Match the activity with the enzyme/proteins. v Scans the DNA to search for the promoter region A.…
A: DNA acts as the genetic material in most organisms. DNA gets transcribed into mRNA with the help of…
Q: In a polyribosome, the polypeptides associated with which ribosomes will be the longest? a. Those at…
A: Ribosomes are involved in translation by building proteins from amino acids using messenger RNA as a…
Q: In the image below, what is the C label pointing to?
A: The above image represents transcription where the RNA polymerase move along the DNA and make the…
Q: What happens immediately after the initiation complex forms during translation? (a) peptide bond…
A: Translation is biological process which involves protein synthesis with the help of mRNA i.e.…
Q: What molecule/feature ensures that the correct amino acid is added to the peptide chain with reading…
A: The process in which the mRNA is converted into the proteins buy the help of particular codon is…
Q: _______is/are removed from a new mRNA. a. Introns c. A poly-A tail b. Exons d. Amino acids
A: Nucleic acids are macromolecules. These are of two types - Deoxyribonucleic acid (DNA) and…
Q: Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of…
A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…
Q: The job of tRNA is to O A. bring amino acids to the ribosome by matching their anticodon to the…
A: The genetic material is used to store the genetic information in the mitochondria or nuclei of an…
Q: Which two of the following statements about transcription are true A. Transcription makes an RNA…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Which of these is the function of a poly (A) signal sequence? A. It adds the poly (A) tail to the 3'…
A: In the yeast the poly (A) signal sequences are present which are short sequences and redundant in…
Q: A regulatory transcription factor protein typically contains _________ that binds to the ________ of…
A: Transcription is the first step in central dogma of protein synthesis. It involves formation of…
Q: A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate…
A: The central dogma depicts the replication of DNA, the transcription of DNA into RNA, and the…
Step by step
Solved in 2 steps
- Energy that drives translation is provided mainly by ______ . a. ATP c. GTP b. amino acids d. ribosomesPortions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps c. poly-A tails d. intronsThe following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
- If a sequence of mRNA is CUG AGU GCA, which of the following is the DNA segment from which it was transcribed? \ a. GAC TCA CGT b. GAG TAC GCC c. CGC ATG CGG d. GAC UCA CGUNumber the following steps of protein synthesis in the order in which they occur, starting with 1 and ending with 9.a. _____ The stop codon is reached, and the polypeptide is released.b. _____ The small ribosomal subunit finds the start codon, and the large ribosomal subunit joins.c. _____ The end of the gene is reached, and the pre-mRNA is released and then edited.d. _____ The transcription factor binds the promoter.e. _____ The protein is folded and modified to become functional.f. _____ RNA polymerase builds the mRNA transcript.g. _____ mRNA and initiator tRNA bind the small ribosomal subunit.h. _____ New tRNA molecules are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site.i. _____ mRNA exits the nucleus via a nuclear pore.The portion of the mRNA transcript that gets removed duringRNA processing is thea. exons.b. introns.c. poly-A tails.d. 5′ caps.e. spliceosomes.
- During the transcription of DNA to mRNA, __________. Group of answer choices a) RNA polymerase moves along the DNA (reads) in the 5’ to the 3’ direction b) the 3’ end of the mRNA molecule is produced first c) RNA polymerase must first bind to a promoter sequence d) transcription is initiated at a “start codon”Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of 2 introns. Show what the final mRNA would look like. 5’ ATTTGCG*AATGAGAGTCC*GCATTACGATG“CAATGCAGTG”TTTAAGCGCGCATTAA 3’If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the corresponding gene is... which of the following answers? a. CTCAAGTGTCATCCG b. GCCTACTGTGAACTC c. 3' GAGTTCACAGTAGGC 5' d. GAGTTCACAGTAGGC e. none of the above
- Number the following steps of protein synthesis in order in which they occur, starting with 1 and ending with 9. a. ____ the stop codon is reached, and the polypeptide is released b.____ the small ribosomal subunit finds the start codon, and the large ribosomal subunit joins. c.____ the end of the gene is reached, and the pre-mRNA is released and then edited. d. ____ The transcription factor bonds the promoter. e. ____ the protein is folded and modified to become functional. f. ____ RNA polymerase builds the mRNA transcript. g. ____ mRNA and initiator tRNA bind the small ribosomal subunit. h. ____ new tRNAs are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site. i. ____ mRNA exits the nucleus via a nuclear pore.Each of the following statements about protein synthesis is false.Correct each to make a true statement. a. In a gene, each nucleotide specifies one amino acid in a protein sequence. b. A transcription factor must bind to the promoter region of a gene before the enzyme DNA synthetase is able to bind and begin transcription. c. The enzyme RNA polymerase builds a strand of transfer RNA, whose codons are complementary to DNA’s triplets. d. Proteins destined for secretion from the cell enter the nucleus after translation, to be folded and modified. e. During translation, amino acids are delivered by the messenger RNA transcripThe sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome: Choose the sequence that would correspond to that mRNA. A: 3’ – TACGGAACG – 5’ B) 3’ – AUGCCUUGC – 5’ C) 5’ – AUGCCUUGC – 3’ D) 3’ – UACGGAACG – 5’ E) 5’ – UACGGAACG – 3’