Which of the following statements concerning D-glucose in INCORRECT? O a. It is a monosaccharide. O b. O C. O d. O e. It is a triose. It has four chiral carbons. The sugar is an aldose. When dissolved in water, it exists as both cycli and linear forms in solution.

Q: 15-24 b) c) Identify the molecules oxidized and reduced in the following reactions: a) CH₂CH₂CHO +…

A: Many redox reactions occur during metabolism. Redox reactions necessitate the transfer or removal of…

Q: The presence of insulin causes the activation of phosphoprotein phosphatase. This leads to the and…

A: PFK-2 indirectly regulates the rates of glycolysis and gluconeogenesis. PFK-2 catalyzes the…

Q: Structure and properties of triacylglycerols, their biological role.

A: Triacylglycerols, also known as triglycerides, are made up of three fatty acids that are…

Q: when v=vmax/2，Km =（S） 1.why？？Need Explaination. What is V and what is Vmax？how is their relationship…

A: In Michael's menton kinetics, Enzymes are known to show Vmax at a particular concentration of…

Q: 4. If a non-science person asks you what protein folding is and how the concept is related to…

A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes that…

Q: The oxidized form of NADH is O NADH+ O NAD+ O NADOH O NADH2 -

A: Metabolism involves the use of many redox reactions. In redox reactions, electrons can either reduce…

Q: 4. Why does DNA use Thymine instead of Uracil?

A: DNA is the type of nucleic acid, double stranded poly-nucleotide chain which work as the genetic…

Q: . Effects of amino acid composition and sequence to protein folding

A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…

Q: Please help me calculate BSA and Net Abs (explaination and details pls)

A: Bovine Serum Albumin (BSA) is the most commonly used protein in research. It is obtained from the…

Q: Just 15-3

A: Kequilibrium constant is the ratio of rate of forward reaction and rate of backward reaction and…

Q: a) Determine kcat (in units of sec-1) for a particular enzyme, given the following information: Vo =…

A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…

Q: 3..° i We seem to be constantly chasing the latest great oil to use for cooking and currently…

A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…

Q: Using the results of linear regression analysis (log(MW, kDa) vs Rr) from the protein standards,…

A: Given that the linear regression analysis data of a plot of Log MW (in kDa) vs Rf is given as:…

Q: In addition to the oxidation of cytochrome c by Comple transport systems, what other reaction is…

A: Introduction The electron transport chain (ETC) is the last part of aerobic respiration. An electron…

Q: Coupling ATP hydrolysis to glucose phosphorylation makes thermodynamic sense, but consider how the…

A: The two individual reactions i.e. glucose phosphorylation and ATP hydrolysis is given below, along…

Q: What shuttle mechanism transfers the electrons from cytosolic NADH into the mitochondria with the…

A: Mitochondrial inner membrane is impermeable to NADH. Hence, for transfer of NADH, it is first…

Q: Why is it critical that NAD* and FAD be regenerated inside the mitochondrial matrix rather than the…

A: NAD+ and FAD are coenzymes derived from vitamin B3 and vitamin B2 respectively. Both NAD+ and FAD…

Q: Why was it necessary to use phosphoaminophosphohlc (ANP) in the ATP synthase enzyme active site…

A: ATP (Adenosine triphosphate) is energy molecule which is pretty stable in aqueous solutions at pH…

Q: Suppose researchers studied the first chromosome of a new species and mapped three genes of…

A: The frequency of recombination is a measure of genetic linkage that is used to create a genetic…

Q: Draw the structure of the a-methyl-pyranoside form of mannose following the reaction of the sugar…

A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…

Q: Glucose 6-phosphate is fed to a cell line capable of utilizing the pentose phosphate pathway and…

A: There is constant interplay between the Pentose Phosphate Pathway (PPP) and Gluconeogenesis. The…

Q: For the net production of a molecule of glucose from CO₂, ribulose-1,5-bisphosphate must react with…

A: Synthesis of glucose from phosphoglycerate occurs through the process gluconeogenesis. ribulose 1,5…

Q: Beer’s Law: In serum cholesterol analysis, if the grad. cylinder that measured the acetic acid…

A: A spectrophotometer can measure the amount of light absorbed by a biomolecule and we can use that…

Q: When a product inhibits an enzyme by binding to the active site, which of the following would occur?…

A: Introduction Enzymes are known as biocatalyst. They increases rate of a chemical reaction by…

Q: Could you help with part d? Create a speciation diagram for histidine by plotting Xi vs pH from pH =…

A: His is a basic amino acids with pKa value of its side chain ~6, amine and carboxyl groups pKa values…

Q: Finally, using the formula to convert between standard states, show that that your calculated values…

A: Chemical standard state is defined by standard conditions in chemical systems. These standard…

Q: 1. Name all the proteins that are in the DNA replication fork in E. Coli, and describe the functions…

A: Introduction DNA acts as genetic material in prokaryotes and eukaryotes.  DNA replication is a…

Q: What is true about lipids?  A. They are polar and therefore soluble in polar solvents B They are…

A: The four classes of biological macromolecules are nucleic acids, proteins, lipids  and…

Q: provide 3 example pathway of oxaloacetate to other biomolecules.

A: Oxaloacetate is a four-carbon-containing organic compound.  It acts as a metabolic intermediate in…

Q: How does ATP regulate the activity of PFK-1? ☐☐ ATP binds to PFK-1 at the catalytic site as a…

A: Glycolysis is a process in which glucose is oxidized & is converted to pyruvate and in that…

Q: Which of the following will contain plain Galactose? Heparin Keratan Dermatan…

A: Carbohydrates can be classified into different types depending on their size into the following…

Q: 1. Describe five major types of lipids.

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: A gerbil is fed a normal diet including 14C-lysine. After a period of time on this diet biopsies are…

A: Gerbils are mammals , so only mammalian metabolism can be used here. In the figure below showing the…

Q: Can human digest this trisaccharide？What bond is it between sugar B and sugar C？（be specific）

A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…

Q: Calculate the mass of invertase (in mg) and  concentration of invertase (in mM) contained in a…

A: Enzyme Activity =Amount of product formedtime The conventional unit used for assigning enzyme…

Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…

A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…

Q: Do carbohydrates and sugars cause weight gain? Briefly Explain the answer.

A: Carbohydrates are biomolecules that act as the major source of energy. Sugars are carbohydrates with…

Q: Why is the name the "citrate cycle" a more accurate name for the metabolic pathway discovered by…

A: Critic acid cycle also called as tricarboxylic acid cycle is the second stage in aerobic cellular…

Q: The pancreas is an organ of mixed secretion. Endocrinely, beta-cells produce the hormone insulin,…

A: Pancreas has 3 types of cells: α cells secrete glucagon β cells secrete insulin δ cells secrete…

Q: (a) A pathway consists of 6 enzymes (p, q, r, s, t, u) that convert substrate J to product X at a…

A: Metabolic pathways are a series of biochemical reactions that convert one biomolecule into another.…

Q: Consider a membrane that has a very high content of phosphatidic acid on the inner leaflet of the…

A: Introduction Proteins are made up of amino acids. Protein plays various function in our body. Two…

Q: 4. Which one of the following requires an energy source? a. a large molecule transported with its…

A: Transport of molecules across the plasma membrane occurs through passive and active transport.…

Q: If the target protein is 0.1% of the total protein in the original mixture, a three-step…

A: Purification is a process by which impurities are removed from a sample and desired component is…

Q: Mannose is the C-2 epimer of glucose. Altrose is the C-3 epimer of mannose. Which of the following…

A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…

Q: Calculate the number of moles of ATP produced from the complete oxidation of 900 g glucose in the…

A: Glucose that enters the cell produces ATP by respiration. The processes involved are glycolysis,…

Q: e. Write the equations involved in the neutralization process of antacids. (Gastrointestinal Agents)

A: Antacids are medicines that are used to treat acidity. Antacids cure acidity by reacting with acids…

Q: In the following structure, the carbon labeled [Select] carbon, the carbon labeled [Select] is…

A: Monosaccharides are the simplest units of sugars. All monosaccharides are either aldoses or ketoses.…

Q: All lipids are absorbed into absorptive cells of the small intestine by which process? Primary…

A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…

Q: is this protein folding funnel from a metamorphic protein? yes or no? is there one intermediate…

A: Anfinsen hypothesis postulates that under native conditions, the three-dimensional structure of a…

Q: 1.How many chiral center does D-Eranose have？ 2. How many stereoisomer are possible for D-Eranose.

A: Conformation is the different positions a molecule can twist into. Configuration is the arrangement…