Mannose is the C-2 epimer of glucose. Altrose is the C-3 epimer of mannose. Which of the following is altrose? OH CH₂OH OH A - OH ОН CH₂OH OH В OH OH CH₂OH OH о О О OH OH OH CH₂OH OH D OH OH OH CH₂OH E О OH OH

Q: A gerbil is fed a normal diet including 14C-lysine. After a period of time on this diet biopsies are…

A: Gerbils are mammals , so only mammalian metabolism can be used here. In the figure below showing the…

Q: 21. _____________________________________ adds acyl groups to two carbons of the backbone of…

A: Triacylglycerol (TAG) are compounds which has 3 acyl groups attached to a glycerol molecule.   Fatty…

Q: 32. During a study of insulin response, a healthy nonobese 24-year-old woman consumes four pancakes…

A: When subjected to a prolonged period of starvation, the level of glucose in the blood falls. This…

Q: Using the following key terms, discuss the regulation of carbohydrate metabolism.  Insulin,…

A: Introduction Glycolysis is a process by which glucose converts into pyruvate and ATP is produced.…

Q: Saturated fatty acids are degraded by the stepwise reactions of oxidation, producing acetyl-CoA.…

A: Simple fats or triglycerides or triacylglycerides are categorized as storage lipids. Triglycerides…

Q: Which of these are artificial sweeteners (Arts) and which are metabolized (Mtbs) by glycolysis?…

A: Artificial sweeteners are synthetic substitutes for sugars. These are sweet in taste and have less…

Q: Suppose a student rinses their buret with water instead of sodium hydroxide, leaving water in the…

A: Introduction The titration is a chemical process by which the quantity of one substance of a sample…

Q: There is a proposal that pyrazole could protect against the damaging effects of alcohol on the liver…

A: Alcohol toxicity happens due to excess consumption of alcohol in short period of time. Oxidative…

Q: true/ false: When proteins are denatured 1°, 2°, 3°, and 4° structure is lost.

A: Denaturation is a process in which proteins lose their original structure or confirmation. The loss…

Q: The pentose phosphate pathway occurs in the mitochondrion of tissues actively engaged in synthesis…

A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…

Q: Starch is a polysaccharide 1.Is starch positive in Bial‘s test？（what color ？） 2.Is starch positive…

A: Introduction: Polysaccharides are polymers of D-glucose that are joined together by glycosidic…

Q: An unknown sample was tested if there is a presence of lipid, after the test it shows that it is…

A: These are the various preliminary and qualitative tests to estimate the presence and nature of…

Q: Show below is a polypeptide comprised of 3 α-helices and 5 β-sheets joined by randomcoil.…

A: Tertiary structure of a protein is the 3-D structure of the polypeptide after it has undergone…

Q: What is the overall net reaction of glycolysis? C6H12O6 + 2 NADH + 2 P₁ + 2 ATP --> 2 C3H3O3 + 2…

A: In glycolysis, glucose is oxidized into pyruvate. It involves a series of enzyme-catalyzed…

Q: Mechanism of action of electron transport inhibitors. Amital.

A: INTRODUCTION : First of all, there is no electron transport inhibitor called Amital, it is a wrong…

Q: Which of the following results are most likely to be observed in liver enzymes following initiation…

A: When subjected to a prolonged period of starvation, the level of glucose in the blood falls. This…

Q: Determine the direction that each of the reactions will progress. Assume that the reactants and…

A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…

Q: The study above was done on a wildtype enzyme and three genetically-engineered mutants. The purpose…

A: INTRODUCTION : Wild type Enzyme - These are the enzymes which are found naturally and are not…

Q: Which of the following statements is correct regarding the structures below? CHO CHO но-н H H-OH ОН…

A: Carbohydrates can be classified into different types depending on their size into the following…

Q: Fatty acids and triglycerides are an important source of nutrition and a dense form of stored…

A: Carbohydrates are the primary source of energy. But in the absence of carbohydrates, the body…

Q: Determine whether each of the examples or phrases describes an essential amino acid, a nonessential…

A: INTRODUCTION: They are the building blocks of proteins and amino Group (NH2) and Carboxyl Group…

Q: In the last stage of cellular respiration (ETS and oxidative phosphorylation) what is the fate of…

A: ETS (Electron Transport System) is a sequential arrangement of proteins (Protein complexes I, II,…

Q: Suppose that you have decided to test whether the tyrosine residue of the spike protein is important…

A: Amino acids are the building blocks of protein. They are classified into different groups like…

Q: What would be the effect of a visualizing agent on the retention factor. Rf? A.Higher Rf B.Lower RF…

A: Visualising agent: The chemical agents that can be used to detect the number and location of the…

Q: Answer the Questions below: 1. Based on the experiment above, what is the means of detecting the…

A: Lipids are hydrophobic compounds that are usually made up of an alcohol backbone and a long chain…

Q: v (micromol/sec) 120 100 80 60 40 20 0 <--X ...... Y 20 40 [A] (micromolar) 60 Enzyme X must have 2…

A: Assuming the enzyme follows Michaelis Mentos's enzyme kinetics.  Km or Kd value is the substrate…

Q: Ribose-5-phosphate is produced by oxidative decarboxylation of 6-phosphogluconate using the enzyme…

A: The pentose phosphate pathway also called the hexose monophosphate shunt is an alternative pathway…

Q: Which of the following first messengers is hydrophobic and binds to a nuclear receptor protein…

A: The first messengers are extracellular biomolecules that bind to the cellular receptor and elicit a…

Q: Draw the electron pushing mechanism

A: Electron pushing mechanism shows the jumping of electrons in the substrate and reaction…

Q: Describe the Molecular Mechanism of Hypertrophic cardiomyopathy: --> Normal molecular physiology…

A: Hypertrophic cardiomyopathy (HCM) is a disease condition of heart (cardiac) in which its muscles get…

Q: (a) Which antibacterial compound does NOT directly inhibit this process? H₂N NH cycloserine A Ph…

A: The given park nucleotide consist of five amino acids linked by peptide bond with sequence of…

Q: 1. Define a polynucleotide. 2. What are the types of polynucleotides? 3. Enumerate and classify all…

A: Nucleotides are the complex compounds made up of nitrogen base, a sugar residuw and a phosphate…

Q: Metabolism is best defined as a collection of Ocellular processes that activate cell division.…

A: Biochemistry is an attempt at explaining the living cell in chemical terms. A living cell is the…

Q: The substitution of His 64 of carbonic anhydrase II with Ala results in a sharp decrease in the…

A: Carbonic anhydrase II is the enzyme that catalyzes the formation of H2CO3 from CO2 and H2O, and…

Q: Make 2 mL of 50 fold dilution of DNA solution and sodium phosphate buffer.  DNA: 400 uL Sodium…

A: Dilution is the process of lowering the concentration of a solution by adding more of solvent to it.…

Q: Examine the membrane lipid pictured below and answer the following questions: a. Is this lipid…

A: Fatty acids are carboxylic acids with a hydrocarbon chain. Fatty acids may be saturated or…

Q: Name the enzymes that catalyse (a) substrate-level phosphorylation and (b) coupled reactions during…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…

Q: Glycogenin is a homodimer of 37 kDa subunits. (Homodimer means identical subunits of type a that…

A: Glycogenin: It is a transferase that produces glycogen, which is a crucial type of glucose storage…

Q: The metabolic function of the pentose phosphate pathway is: act as a source of ADP biosynthesis O…

A: The breakdown of glucose, in glycolysis provides the starting molecule required for the pentose…

Q: Question 2 Briefly explain how the antioxidant activities of tocochromanol natural products can be…

A: Tocopherol and tocotrienols are collectively called vitamin E. There are four tocotrienols found in…

Q: Which statement is CORRECT? A) Glucokinase is not inhibited by glucose-6-phosphate B) Pyruvate…

A: INTRODUCTION : Glycolysis - It is a metabolic pathway in which glucose is metabolised / broken down…

Q: Given: Beer-Lambert Law A = Ecl E = 8000 for Met myoglobin E= 14,000 for oxy-myoglobin l=1 cm…

A: According to Beer-Lambert law the concentration of the sample is directly proportional to the…

Q: NA beig sis is a compicated pro cids. Complete the DNA-to-amino acid table for three consecutive…

A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…

Q: The structure given below represents what molecule? CHO I H-C-OH I CH₂OH dihydroxyacetone phosphate…

A: The molecular weight of glyceraldehyde, a pleasant, white, crystalline solid, is 90.08 g mol 1. 29…

Q: Which of the following is arranged from least to most in terms of number of sugar units ?…

A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…

Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…

A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…

Q: 6. Biological value of glycogen breakdown in muscles and liver.

A: Carbohydrates are biomolecules that are utilized as the primary source of energy. And glucose is the…

Q: Which of the following regarding the Electron Transport Chain is INCORRECT? It can accept electrons…

A: Aerobic metabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in TCA cycle + 2…

Q: 4. Shown below is the structure of the anti-retroviral drug AZT. 5' HOCH, H 3 N₂ HN AZT H 12 H CH₂…

A: AZT is a drug that is used to treat HIV. HIV is a retro virus that causes the syndrome AIDS. When…

Q: true/false:  Pepsin cleavage of the peptide Ala-His-Gly-Trp-Val-Ile-Arg-Gly would yield the…

A: Pepsin is a proteolytic Enzyme that cleaves the peptide bonds with specificity. This can be used in…