If the side chain for the amino acid threonine got close to the side chain for the amino acid histidine on the inside fa protein, what kind of intermolecular forces could form between the two side chains? induced dipole-induced dipole forces dipole-dipole forces hydrogen bonds none of the above
Q: form of energy called ATP. a) How does the structure of ATP enable its function?
A: Introduction Cellular respiration consists of many metabolic processes that occur inside cells to…
Q: C3bBb is the soluble C3 convertase that initiates the alternative pathway, while iC3bBb is the C3…
A: The answer is false.…
Q: Identify three body systems that are directly involved in kicking a ball and how the three systems…
A: INTRODUCTION Mascular system This include skeletal, smooth and cardiac muscles. Skeletal system…
Q: What is the rate of volume change (ml/hr)
A: As per the question, the formula to calculate the rate of volume change is: Rate of volume change…
Q: Explain how did Pierre Louis coined the term typhoid fever from people who died with gastric fever.
A: Introduction :- Salmonella Typhoid fever is caused by bacteria called Typhi. Salmonella Paratyphoid…
Q: 28. A 62-year-old man has adenocarcinoma with lymph node metastases in the proximal portion of the…
A: Introduction Cancer is caused due to uncontrolled and abnormal division of the cells of the body.…
Q: Briefly explain, using a concrete example, how allopatric speciation can lead to the appearance of a…
A: New species arise through a process called speciation. In speciation, an ancestral species splits…
Q: A) Identify the type of bone [based on shape ]seen here. B) Identify parts A and B. B
A: INTRODUCTION Femoral bone Femur is the thigh bone, it is the longest and strongest bone in the body.
Q: Which of the following is NOT true of Innate Lymphoid Cells (ILCs)? A) Each ILC type responds to a…
A: Innate lymphoid cells are immune cells that mirror the phenotype and function of T cells. It…
Q: Could you also explain how DNA fingerprinting becomes a disadvantage as it pertains to relatives or…
A: Introduction DNA fingerprinting is a laboratory technique that uses the nucleotide sequences of…
Q: Gene flow: Non-random mating: Genetic Drift: Founder Effect: Bottleneck Effect: Stabilizing…
A: Introduction Evolution is the process of a species' features changing over numerous generations…
Q: Which of the following allows eyes to focus on objects both nearby and far away? the pupil the lens…
A: Answer :- The ability of the attention lens to regulate its focal distance is named as power of…
Q: In a large population of range cattle, the following ratios are observed: 49% red (RR), 42% roan…
A: Introduction Allele frequencies are used in population studies to determine what fraction of…
Q: Describe the major plant taxonomic groups and representative members of each group.
A: R.H. Whittaker gave the Five Kingdom classification for living organisms. These five kingdoms were…
Q: All of the following are distinctions between the process of mitosis and meiosis EXCEPT: Group of…
A: Cells divide and reproduce in two ways, mitosis and meiosis. Mitosis is a process where a single…
Q: Но CH2OH ОН ОН 1- НО CH 2 ОН -О. ОН ОН
A: Carbohydrate are the polymers form via joining of many monosaccharide units. Carbohydrate are of…
Q: Susie has two plants. Both are exposed to the same amount of sunlight, are grown in the same kind of…
A: Control and experimental group In an experiment, the experimental group is given a specific…
Q: True or False: An individual with sickle-cell anemia is caused by a missense mutation.
A: Missense mutation is a type of genetic alteration in which a single base pair substitution alter…
Q: In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR…
A: Introduction A mutation is a change in the structure of a gene, which is the fundamental unit of…
Q: ACTIVITY RESULT: Give the respiratory rate in the following conditions, explain the changes of pulse…
A: Introduction The respiration rate is the number of times a person respires in one minute. A healthy…
Q: Explain different types of reproduction.
A: The biological process by which new distinct organisms, or "offspring," are created from their…
Q: 19. A 22-year-old man who was recently diagnosed with type 1 diabetes mellitus has learned to test…
A: Diabetes 1 is a chronic disorder. Due to this disorder the patient pancreas produces little or no…
Q: scientist observing a cell during gene expression would be able to easily distinguish it as a…
A: Transcription The process in which DNA molecules is coded into mRNA with the help of enzymes.
Q: What is the function of the axon? to receive information and information into the cell body to store…
A: The neuron is the functional unit of the nervous system. The neurons send and receive signals from…
Q: Lab was on the translation process from mRNA to amino acid, post-translational modification of…
A: Introduction Protein biosynthesis is an important biological process that takes place inside cells…
Q: Answer based on the question above: You have isolated a new eukaryotic microorganism and want to…
A: Introduction The genetic code is a set of rules or laws that define how DNA's four-letter code is…
Q: Which type of base pairs take the most energy to break in a DNA double helix? a. A-T base pairs b.…
A: DNA replication is a process in which DNA makes copies of itself with the help of the enzyme DNA…
Q: Code 1: Write an equation that models the population of the bacteria, given the number of hours…
A:
Q: A)Identify the parts of the vertebra arrows A and B point to. B) Which series of vertebrae does this…
A: The human vertebral column is divided into five regions - cervical, thoracic, lumbar, sacrum, and…
Q: Foraminifera and coccolithophore shells (calcareous sediments) are more commonly found ______. a.…
A: Ooze Ooze is the sirf deposit of material on the bottom of the water body.
Q: 17. Phototransduction in retinal rod cells in response to light is triggered by which of the…
A: The retina is the layer of the eyes that has photoreceptors.
Q: A scientist working in an IVF (in vitro fertilization) clinic mistakenly produced a human zygote…
A: Genotype of the population is a number of populations with the given genotype and is calculated by…
Q: Why do we need to eat protein-rich food and how does its structure relate to its function?
A: Proteins are huge, complex molecules that assume numerous basic roles in the body. They do the vast…
Q: Create a metabolic pathway map that includes "the 4 Gs": glycolysis, gluconeogenesis, glycogen…
A: Glycolysis is The process by which glucose is converted into pyruvate. Gluconeogenesis is the…
Q: Do you think only respiratory muscles are impacted by pH changes? Would other areas in our body also…
A: Answer :- As we know that the respiratory system controls plasma pH by changing the [CO2]. The…
Q: What is the function of computer graphics in medicine?
A: Q. Importance of computer graphics in medicine.
Q: The marks a spot of dead myocardial cells. How does this change the depolarization and muscle…
A: Myocardial cells myocardial cells are located in the heart forming a branched network in the heart,…
Q: Suggest how the weak points of the Molisch test for carbohydrates can be strengthened by comparing…
A: Introduction Carbohydrates, often known as sugar molecules, are sugar molecules. Carbohydrates are…
Q: A) Additional origin of replication is included B) Chromosome is circular C) Enhancer region is…
A: Duplication of a stretch of DNA means that the same stretch is replicated and added to any reason of…
Q: The hematoma illustrated in the drawing shown is most likely to be due to tearing of which of the…
A: A blood clot within the skull is known as an intracranial hematoma. The rupture of a blood artery…
Q: 47. Which of the following regions of the retina is capable of the highest spatial resolution and…
A: Introduction :- The retina connects the light that enters your eyes to the images that you see. Your…
Q: All of the following are types of light microscopes except electron phase-contrast Obright-field O…
A: Introduction Micoscope is a laboratory instrument. It is used to observe very small object which can…
Q: What is the primary standard for iodine solutions?
A: INTRODUCTION Iodine solution It is a disinfectant and antiseptic agent, used to prevent infection in…
Q: How might an understanding of the method by which gonorrhea is evolving resistance to certain…
A: Neisseria gonorrhoeae has developed resistance to a number of drugs already. They are penicillin,…
Q: Which of the following statement about RNA is FALSE? rRNA is critical for protein synthesis as it is…
A: Ribonucleic acid (RNA) is a nucleic acid which has similar features to DNA and is found in all…
Q: What is the differences between ocular magnification and objective magnification?
A: Introduction A microscope's objective lens is the one near the sample at the bottom. It's an…
Q: Scientists wanted to determine what molecule held the 'gene'. If they did a study in which a cell…
A: A virus is an infectious microbe consisting of a segment of nucleic acid (either DNA or RNA)…
Q: 2a) Which of the following statements about pyruvate oxidation IS TRUE? a. NADH is oxidized in the…
A: The answer to the above questions are given below -
Q: The incubation period for salmonellosis (enteritis) is longer than for staphylococcal food poisoning…
A: Incubation period: It is the number of days between when you're infected with something and when…
Q: neurotoxin
A: Tetrodotoxin is the neurotoxin which acts as a sodium channel blocker . It binds to the voltage…
Good explanation
Asap thanks
Step by step
Solved in 2 steps
- 3. (i) Referring to the genetic code (the codon usage table), what would be the amino acidsequence of the polypeptide encoded by the following mRNA sequence?5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’(ii) What would be the effect on translation of the above sequence of a single base (point)mutation which gave rise to an A instead of a U at the twelfth base?(iii) What would be the effect on translation of the sequence in (i) above, if an extra Cwere inserted between the third and fourth bases, i.e., between the two Gs at position 3and 4?HbS results from the substitution of valine forglutamic acid at the number 6 position in the b chainof human hemoglobin. HbC is the result of a change atthe same position in the β chain, but in this case lysinereplaces glutamic acid. Return to the genetic code table and determine whether single-nucleotide changes can account for these mutations. Then view and examine the R groups in the amino acidsglutamic acid, valine, and lysine. Describe the chemicaldifferences between the three amino acids. Predict how thechanges might alter the structure of the molecule and leadto altered hemoglobin function.The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?
- Taking start and stop codon into consideration, if we have an mRNA sequence with 30 nucleotides, how many amino acids would be found in the resulting polypeptide (protein chain)? Why?Exploring the Structure of the 30S Ribosomal Subunit Go to www.pdh.org and bring up PDB file 1GIX, which shows the 30S ribosomal subunit, the three tRNAs, and mRNA. In the box on the right titled ‘Biological Assembly.� click “More Images.� and then scroll down to look at the Interactive Vic By moving your cursor over the image, you can rotate it to view it from any perspective. a. How are the ribosomal proteins represented in the image? b. How is the 16S rRNA portrayed? c. Rotate the image to see how the tRNAs stick out from the structure. Which end of the tRNA is sticking out? d. Where will these ends of the tRNAs lie when the 50S subunit binds to this complex?Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.
- Consequences of the Wobble Hypothesis Point out why Cricks wobble hypothesis would allow fewer than 61 anticodons to be used to translate the 61 sense codons. How might wobble tend to accelerate the rate of translation?Alternative Splicing Possibilities Suppose exon 17 were deleted from the fast skeletal muscle troponin T gene (Figure 29.46). How many different mRNAs could now be generated by alternative splicing? Suppose that exon 7 in a wild-type troponin T gene were duplicated. How many different mRNAs might be generated from a transcript of this new gene by alternative splicing?A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new protein with high similarity to the lysylphosphatidylglycerol flippase enzyme. A short section of the new protein sequence is shown below. TVEVNAPGDVQKALSELQQINDGRLDIRI (a) Are any reverse turns likely to be present? Explain your answer. (b) Are any beta-strands likely to be present? Explain your answer. (c) Are any alpha helices likely to be present? Explain your answer. (d) Is any supersecondary structure likely to be present? Explain your answer. (e) Identify two residues that are likely to be buried in the core of the folded protein. Explain your answer. (f) Identify two residues that are likely to be hydrogen bonded to each other. Explain your answer.
- My PDB code: 3GRS residue point: HIS467 mutation: LEU Describe why this position in your protein is important and outline the effects the mutation will have on the 3D structure and the function of your protein. (up to 50 words)Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′