Which outcome most likely results from exposure ofOgg1 mice to TNFaO A.Increase in cancer incidence.O B. Increase in Cxc/1 expressionO C. Decrease in cellular ROS levelsO D. Decrease in Kp of TH5487 for its targetTH5487 acts as which type of inhibitor?O A. CompetitiveO B. MixedO C. NoncompetitiveO D. UncompetitiveBased on data shown in Figure 2, what are the effects ofOGG1 and TH5487 on Cxc/1 expression?I. OGG1 reduces the TNFA induced Cxc/1 expression.II. OGG1 stimulates the TNFa induced Cxc/1expression.III. TH5487 reduces the OGG1-mediated Cxc/1expression.IV. TH5487 stimulates the OGG1-mediated Cxc/1expression.O A. I and III onlyO B. I and IV onlyOC. II and III only.O D. II and IV onlyResearchers measured the NF- KB occupancy of theCxcl2 promoter following exposure to TNFa both in thepresence and absence of TH5487. Based on the datapresented in the passage, which figure depicts theexpected results?O A.OB.O C.COD.NF-KB occupancyTNFa:TH5487:NF-KB occupancyTNFa:TH5487:NF-KB occupancyTNFa:TH5487:NF-KB occupancyJIL.I.TNFa:TH5487:ا..++++++++ Upon exposure to pro-inflammatory agents suchas TNFA, cells produce reactive oxygen species(ROS), which can react with guanine bases in DNA togenerate 8-oxo-G. This modified guanine canparticipate in Hoogsteen base pairs with adenine, anevent that upon DNA replication results in G to T andC to A mutations. Guanine-rich promoter regions areparticularly susceptible to this type of ROS-inducedDNA damage.OGG1 is a DNA glycosylase that recognizes 8-oxo-G. OGG1 is involved in two processes: base excisionrepair of 8-oxo-G as well as transcription initiation forpro-inflammatory genes such as Cxcl familymembers. These transcription events also involvebinding of NF-KB to promoters as NF-KB recruitmentincreases dramatically following OGG1 binding toDNA.TH5487 is a compound that mimics 8-oxo-Gstructure and binds to the active site of OGG1. Usingreverse-transcription PCR (RT-PCR), researchersexamined whether increasing levels of TH5487affected the expression of a pro-inflammatory genefollowing TNFa exposure (Figure 1). Next, theresearchers exposed both wild-type and Ogg1-knockout (Ogg1-/-) mice to TNFa in the presence andabsence of TH5487 and monitored Cxc/1 expressionlevels (Figure 2).mRNA levels (%)Figure 1100.Figure 280-60+40+20-00Cxc/1 expression5TNFα:TH5487:1015[TH5487] (UM)wild-type□Ogg1-/-0.Effect of TH5487 on pro-inflammatorygene expression levels followingexposure to TNFa20Cxc/1 expression levels for wild-type andOgg1- mice in the presence (+) andabsence (-) of TNFa and TH5487

DNA and RNA are biomolecules that carry genetic information between different generations of cells.…

Which outcome most likely results from exposure of Ogg1 mice to TNFa O A. Increase in cancer incidence O B. Increase in Cxc/1 expression O C. Decrease in cellular ROS levels O D. Decrease in Kp of TH5487 for its target TH5487 acts as which type of inhibitor? O A. Competitive OB. Mixed O C. Noncompetitive O D. Uncompetitive Based on data shown in Figure 2, what are the effects of OGG1 and TH5487 on Cxc/1 expression? I. OGG1 reduces the TNFa induced Cxc/1 expression. II. OGG1 stimulates the TNFa induced Cxc/1 expression. III. TH5487 reduces the OGG1-mediated Cxc/1 expression. IV. TH5487 stimulates the OGG1-mediated Cxc/1 expression. O A. I and III only OB. I and IV only O C. II and III only O D. II and IV only Researchers measured the NF- KB occupancy of the Cxc/2 promoter following exposure to TNFa both in the presence and absence of TH5487. Based on the data. presented in the passage, which figure depicts the expected results? TNFα: TH5487: II LI TNFa: TH5487: + + O A. O B. O C. O D. NF-KB occupancy NF-KB occupancy L.I. NF-KB occupancy TNFa: TH5487: NF-KB occupancy + L... TNFα: TH5487: + + + + + +

Which outcome most likely results from exposure of Ogg1 mice to TNFa O A. Increase in cancer incidence O B. Increase in Cxc/1 expression O C. Decrease in cellular ROS levels O D. Decrease in Kp of TH5487 for its target TH5487 acts as which type of inhibitor? O A. Competitive OB. Mixed O C. Noncompetitive O D. Uncompetitive Based on data shown in Figure 2, what are the effects of OGG1 and TH5487 on Cxc/1 expression? I. OGG1 reduces the TNFa induced Cxc/1 expression. II. OGG1 stimulates the TNFa induced Cxc/1 expression. III. TH5487 reduces the OGG1-mediated Cxc/1 expression. IV. TH5487 stimulates the OGG1-mediated Cxc/1 expression. O A. I and III only OB. I and IV only O C. II and III only O D. II and IV only Researchers measured the NF- KB occupancy of the Cxc/2 promoter following exposure to TNFa both in the presence and absence of TH5487. Based on the data. presented in the passage, which figure depicts the expected results? TNFα: TH5487: II LI TNFa: TH5487: + + O A. O B. O C. O D. NF-KB occupancy NF-KB occupancy L.I. NF-KB occupancy TNFa: TH5487: NF-KB occupancy + L... TNFα: TH5487: + + + + + +

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 10P: Homologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli...

See similar textbooks

Similar questions

You are studying tumor cells excised from a patient with suspected Colorectal cancer and you will like to evaluate the status of the DNA repair mechanisms in the tissues. Which of these will be helpful in estimating the functional status of the DNA repair mechanisms in this tissue? Group of answer choices Monoubiquitinated FANCD2 protein PhosphorylatedDNA-PK DNA-damage induced foci All of these
. Using a cDNA library, you isolated two differentcDNA clones that have sequences indicating that theyboth correspond to mRNAs transcribed from the samenerve growth factor gene. The beginning and endingsequences of the clones are the same, but the middlesequence is different. How can you explain the different cDNAs?
There may be more than one correct answer for each Which of the following motifs can be found in DNA-binding proteins? a.) helix-loop-helix b.) zinc fingers c.) leucine zippers d.) CpG islands Which of the following motifs can be used to bind protein dimers? a.) helix-loop-helix b.) zinc fingers c.) leucine zippers d.) CpG islands Which of the following are correct regarding enhancers? a.) Enhancers may be located a great distance from the initiation site they regulate. b.) Enhancers can be either upstream or downstream from the initiation site. c.) Enhancers directly bind DNA and prevent binding of activators to the DNA. d.) Enhancers may function in either orientation (forward or backward).
The RNA polymerase from bacteriophage T7 diff ers structurally from prokaryotic and eukaryotic RNAPs and is extremely specifi c for its own promoter. Why do these properties make T7 RNAP useful in experiments with recombinant DNA?
Homologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli leads to the formation of regions of heteroduplex DNA. By definition, such regions contain mismatched bases. Why doesnâ€™t the mismatch repair system of E. coli eliminate these mismatches?
Dyskeratosis congenita (DKC) is a rare human genetic disorderaffecting telomere replication. Mutations in the genesencoding the protein or RNA subunits of telomerase resultin very short telomeres. DKC symptoms include bone marrow failure(reduced production of blood cells) and anemia. If symptoms aresevere, a bone marrow transplant may be the only form of effectivetreatment. In one case, clinicians recommended that a 27-yearoldwoman with a dominant form of DKC undergo a bone marrowtransplant to treat the disorder. Her four siblings were tested, andher 13-year-old brother was identified as the best immunologicallymatched donor. However, before being tested, he was emphaticthat he did not want to know if he had DKC. During testing, it wasdiscovered that he had unusually short telomeres and would mostlikely develop symptoms of DKC. Although the brother is an immunologically matched donor forhis sister, it would be unethical for the clinicians to transplantbone marrow from the brother to…
Dyskeratosis congenita (DKC) is a rare human genetic disorderaffecting telomere replication. Mutations in the genesencoding the protein or RNA subunits of telomerase resultin very short telomeres. DKC symptoms include bone marrow failure(reduced production of blood cells) and anemia. If symptoms aresevere, a bone marrow transplant may be the only form of effectivetreatment. In one case, clinicians recommended that a 27-yearoldwoman with a dominant form of DKC undergo a bone marrowtransplant to treat the disorder. Her four siblings were tested, andher 13-year-old brother was identified as the best immunologicallymatched donor. However, before being tested, he was emphaticthat he did not want to know if he had DKC. During testing, it wasdiscovered that he had unusually short telomeres and would mostlikely develop symptoms of DKC. Why might mutations in genes encoding telomerase subunitslead to bone marrow failure?
If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
a. Why is it impossible to induce nonsense mutations(represented at the mRNA level by the triplets UAG,UAA, and UGA) by treating wild-type strains with mutagens that cause only A• G → T• C transitions in DNA?b. Hydroxylamine (HA) causes only G• C → A• T transitions in DNA. Will HA produce nonsense mutations inwild-type strains?c. Will HA treatment revert nonsense mutations?
Dyskeratosis congenita (DKC) is a rare human genetic disorderaffecting telomere replication. Mutations in thegenes encoding the protein or RNA subunits of telomeraseresult in very short telomeres. DKC symptoms include bonemarrow failure (reduced production of blood cells) and anemia.If symptoms are severe, a bone marrow transplant may be theonly form of effective treatment. In one case, clinicians recommendedthat a 27-year-old woman with a dominant form of DKCundergo a bone marrow transplant to treat the disorder. Her foursiblings were tested, and her 13-year-old brother was identifiedas the best immunologically matched donor. However, beforebeing tested, he was emphatic that he did not want to knowif he had DKC. During testing, it was discovered that he hadunusually short telomeres and would most likely develop symptomsof DKC. Although the brother is an immunologically matched donor for his sister, it would be unethical for the clinicians to transplant bone marrow from the brother to…
Unlike linker DNA and deproteinized DNA, DNA segments wrapped around histone cores are relatively resistant to the hydrolytic actions of nucleases. Explain.
Most laboratory strains of E. coli contain site-specific DNA methylases. The methylase encodedby the dam gene (Dam methylase) transfers a methyl group from S-adenosylmethionine (SAM) tothe N6 position of the adenine residues in the sequence GATC. The Dcm methylase (encoded bythe dcm gene) methylates the internal cytosine residues in the sequences CCAGG and CCTGG atthe C5 position.The E. coli strain used in this experiment is mutated so Dcm and Dam methylases are notfunctional. What is the advantage of using dcm or dam mutants when the E. coli will be a host torecombinant DNA? HINT – If the E. coli methylates the DNA in these cells, then how would thisaffect the activity of restriction endonucleases