Which of these is not considered a method of DNA extraction? organic filtration differential purification all of the above are extraction methods
Q: whats is the function of the following chemicals in DNA extraction ; salt solution , soap solution…
A: DNA is the genetic material that is present within the nucleus of the cell. It is a double-stranded…
Q: The three steps of a PCR reaction are Denaturation, polymerization and annealing Annealing,…
A: Scientists developed the polymerase chain reaction technology after combining a technique for…
Q: Which of the following technique is used for the amplification of DNA fragments?a) AFLPb) RFLPc)…
A: RFLP (restriction fragment length polymorphism) is a technique used to exploit the variation in the…
Q: hat are the steps in creating a dna profile
A: DNA profiling is also known as DNA fingerprinting. It is often used to identify the origin and…
Q: plication of pcr technique.
A: PCR: Polymerase chain reaction.
Q: You are given the following DNA fragment to sequence: 5'-GCTTAGCATC-3'. You first clone the fragment…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: Genetically engineered human insulin, human growth hormone, and human clotting factor VIII are made…
A: Answer is c.) transgenic bacteria.
Q: Hyrolysis of DNA Test Results 1. Inorganic Phosphate 2. Purines 3. Deoxyribose
A: Hydrolysis of DNA will cause the DNA backbone to break down and ultimately give the deoxyribose…
Q: The laboratory has lost the protocol to follow during the PCR reaction and only give you this.…
A: PCR or polymerase chain reaction is a method used for amplifying a small DNA sample. From a small…
Q: What do the peaks on the output graph of the mass spectrometer correspond to when peptide…
A: Mass spectrometer(MS) is an instrument/tool used to measure the mass-to-charge ratio of molecules in…
Q: A piece of DNA is cut into four fragments as shown below. A solution containing the four fragments…
A: Electrophoresis is a technique used to separate charged particles like protein, RNA, and DNA. It is…
Q: how to increase the cloning procedure's plating efficiency.
A: cloning efficiency is a measure of accuracy, providing information on the number of correct clones…
Q: Which of the following is not a method used in genetic testing?a. Chromosome walkingb. DNA…
A: Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…
Q: Which of the following techniques separate molecules by size using electric charge? a. Group of…
A: In molecular biology many techniques are used for different purpose like PCR is used to generate…
Q: Which of the following is not denatured by heating steps during PCR?a) DNA polb) RNA polc)…
A: PCR is polymerase chain reaction. It is a technique which is used to make multiple copies of DNA.…
Q: Which of the following ingredients does not belong in a PCR reaction? DNA polymerase B) Primer…
A: Polymerase chain reaction is a method used to produce millions of copies of any DNA sample and hence…
Q: Prepare a simple flowchart of the experimental procedures for Bacteria Preparation and…
A:
Q: I have a 1.270 ug/uL dna stock, how would you dilute this to 50ng/nL in a single dilution step
A: Formula - 1 ug = 1000 ng Dilution = initial volume / final volume = final concentration / initial…
Q: PCR technique is based on DNA transcription. True False
A: Introduction : PCR (polymerase chain reaction), the reaction mixture includes the DNA extract…
Q: •DNA structure •DNA isolation •DNA isolation methods DNA purification urifi
A: DNA, or deoxyribonucleic acid, is the genetic material in people and in other remaining life forms.…
Q: DNA concentration is 3.75 ng/ ul = the dilution factor is 1:______ we add____ uL dna extract to ____…
A: DNA shows an absorbance maxima at 260 nm and the absorbance is proportional to the concentration of…
Q: Drag and drop the appropriate text in the gaps below. Firstly, the plasmid DNA in the E. coli is…
A: Joshua Lederberg created the term "plasmid" in 1952. Plasmids are genetic elements which are…
Q: Which of the following ingredients does not belong in a sequencing reaction? ddNTPs Primer © Ligase…
A: Sequencing of DNA The technique to know the exact order of base pairs (nucleotide) in a DNA.
Q: True or false: During DNA isolation, ice cold 95% ethanol is used to digest the DNA into fragments…
A: During DNA isolation 95% ethanol is used for DNA precipitation not for DNA digestion and while we…
Q: During dna electrophoresis.....fragments migrate toward the..... electrode fasterthan…
A: Gel Electrophoresis is a widely used technique in molecular biology and biotechnology in which…
Q: A lawn of bacteria is placed on the agar surface of a plate and then exposed to UV for 5 minutes.…
A: Bacteria come under the category of single celled, tiny creatures that can be found in all the…
Q: What is the role of the following in the alkaline plasmid screen? G buffer (Cell Suspension…
A: G buffer (Cell suspension solution): It is a solution that consists of a mixture of Tris (pH 7.5)…
Q: Proteomics analyses samples using electrophoresis and mass spectrometry. True False
A: Proteomic analysis which is also known as proteomics is referred as the branch in which the…
Q: thanol has been carried over into your DNA sample (two answers possible here, select both of them)…
A: DNA is not soluble in ethanol . But when ethanol is there DNA gets separated by forming white…
Q: The production in a pcr reaction is: nucleotids double strand circular dna double stranf linear…
A: PCR stands for polymerase chain reaction.
Q: What would happen if we use an endonuclease on DNA obtained from human cells(without PCR) & then…
A: The endonuclease and the exonuclease are the 2 types of restriction enzymes. They cut the DNA…
Q: Which plate could represent the results of the transformation experiment positive control plated on…
A: Transformation can be defined as the process in which the plasmid of the bacteria is replicated. It…
Q: This is the set-up of our experiment. There are four plates shown: LB only (a type of nutrient…
A: Bacterial transformation is the process by which bacterial competent cells take up naked DNA. The…
Q: Complete this Master Mix table for 8 DNA samples, a positive control, negative control, and an extra…
A: Volume per tube (uL) number of reactions volume in master mix (uL) PCR buffer 1.2 11 13.2 dNTP…
Q: How do the following factors affect the activity of restriction enzymes? pH conditions Mg2+…
A: Restriction enzymes (restriction endonucleases) are the enzymes that can cleave at specific sites in…
Q: hematic diagram for the procedure in doing DNA extraction, isolation and quantification
A: The deoxyribonucleic acid isolation method frees deoxyribonucleic acid from the cell and {so}…
Q: The sample furthest to the left contains the DNA size standards. What is the purpose of this sample?…
A: Gel electrophoresis is an analytical technique in which DNA fragments in a sample are separated…
Q: DNA from a human has been inserted into a bacterial plasmid and reinserted back into the bacterium.…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Tailed primer can have restriction enzyme sites. True False
A:
Q: Nucleic Acid Hybridization Technique Northern Blot Western Blot Transblot Molecules involved (DNA,…
A: Nucleic acid hybridization technique Northern blot Western blot Transblot…
Q: Which of the given statements is correct in the context of visualizing DNA molecules separated by…
A: In Agarose Gel electrophoresis DNA fragments are separated under size. The negatively charged DNA…
Q: A piece of DNA is cut into four fragments as shown below. A solution containing the four fragments…
A: Electrophoresis is a laboratory technique used to separate DNA, RNA, or protein molecules based on…
Q: Identify the component of the solution which is the extracted DNA
A: Everything living contains DNA. This DNA can be isolated for a variety of molecular biology…
Q: A probe is a full section of DNA or RNA that has been labeled with a tracer. True False
A: DNA or RNA probe are nothing but the stretches of single stranded DNA or RNA which are labelled with…
Q: true or false. if microbe A or microbe B have the whole genome similarity of 68% as determined by…
A: DNA is the genetic material that is responsible for the heredity of the organism. In due course of…
Q: Why PCR needs the following: DNA template Primers DNA polymerase enzymes dNTPs Buffer Mg2+
A: Template:- There are several available methods for purification of RNA an DNA. While these are all…
Q: Double stranded DNA is denatured in the presence of high heat low heat high pressure acidic…
A: According to Bartleby guidelines , we are required to attempt first question in case of multiple…
Q: When would you use Edman degradation method and mass spectrometry in protein sequencing experiment
A: Edman degradation is a process of purifying protein.During the process of purification, protein gets…
Q: Which step is not included in polymerase chain reaction (PCR)? Annealing Extension Transformation…
A: Transformation step is not included in polymerase chain reaction(PCR )
Q: What is PCR? Why does Taq polymerase work better than a typical DNA Polymerase isolated from E. coli…
A: A groundbreaking move for molecular biology has been demonstrated by the discovery of polymerase…
Step by step
Solved in 2 steps
- Question 1. Although we will not be doing a gel electrophoresis, data from a gel digest of a Bacillus anthrax plasmid is provided so you can do a DNA map. The Bacillus anthrax plasmid is 4000bp (4Kb) long. Note the origin position as well as the reference molecular weight markers on the gel. Two restriction enzymes, A and B, were used to obtain two individual digests, A and B. They were combined to produce the third digest. The restriction enzyme fragment pattern for the digest of Bacillus anthrax plasmid Determining the Number of Fragments How many fragments were produced by enzyme A? How many fragments were produced by enzyme B? How many fragments were produced by the combined digest (A and B)? Fragment Size Fragment size is relative to molecular weight, and must be determined by comparing the fragment distance to the molecular weight markers. The fragment size has been provided on the gel pattern for this exercise. To make a map you must determine the relative positions of the…QUESTION NO. 1 Patients with the rare genetic disease xeroderma pigmentosum (XP) are very sensitive to light and are highly susceptible to skin cancers. The study of such patients has enhanced our knowledge of DNA repair because XP is caused by defective DNA repair nucleotide excision repair. (A variant, XP-V, is deficient in postreplication repair.) In nucleotide excision repair A. removal of the damaged bases occurs on only one strand of the DNA. B. only thymine dimers generated by UV light can be removed . C. the excision nuclease is an exonuclease. D. a single multifunctional enzyme carries out the repair process. E. only the damaged nucleotides are removed. QUESTION NO.2 Homologous recombination: A. occurs only between two segments from the same DNA molecule. B. requires that a specific DNA sequence be present. C. requires one of the duplexes undergoing recombination be nicked in both strands. D. involves a…QUESTION 24 During lagging strand synthesis of DNA, Okazaki fragments are linked together by ___________. DNA polymerase I Primase Beta clamps DNA Ligase
- QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.QUESTION 9 These are enzymes that untwist the double helix at the replication forks of replicating DNA. Helicases Stingle-strand binding proteins Topoisomerase TelomeraseQUESTION 25 During lagging strand synthesis of DNA, the RNA primers are replaced with DNA by __________. DNA Polymerase I DNA Polymerase II DNA Polymerase III Primase
- QUESTION 27 Which of the following methods can be used to compare the amounts of one specific mRNA that is expressed by two different cell lines? A. Immunohistochemistry B. Western blotting C. Polymerase chain reaction (PCR) D. ImmunocytochemistryQUESTION 1: Several factors (e.g., time and voltage) affect migration of DNA fragments through the agarose gel. Briefly explain how each of these factors affects DNA migration.QUESTION NO. 1 Base excision repair A. is used only for bases that have been deaminated. B. uses enzymes called DNA glycosylases to generate an abasic sugar site. C. removes about 10 to 15 nucleotides. D. does not require an endonuclease. E. recognizes a bulky lesion. QUESTION NO. 2 Termination of a prokaryotic transcriptA. is a random process. B. requires the presence of the rho subunit of the holoenzyme. C. does not require rho factor if the end of the gene contains a G-C rich palindrome. D. is most efficient if there is an A-T-rich segment at the end of the gene. E. requires an ATPase in addition to rho factor. QUESTION NO. 3 Eukaryotic transcription A. is independent of the presence of upstream consensus sequences. B. may involve a promoter located within the region transcribed rather than upstream. C. requires a separate promoter region for each of the three ribosomal RNAs transcribed. D. requires that…
- Question 1. The nitrogenous base content of a sample of DNA was found to be 34% adenine. Determine the amounts of the other three bases in this sample.Question Number 3: Write the sequence of the mRNA molecule synthesized from a DNA template coding strand having the sequence 5’ – ATCGTACCGTTA – 3QUESTION NO. 1 A transition mutation A. occurs when a purine is substituted for a pyrimidine or vice versa. B. results from the insertion of one or two bases into the DNA chain. C. is most frequently caused by chemicals (like acridine) that intercalate into DNA. D. results from substitution of one purine for another or of one pyrimidine for another. E. always is a missense mutation QUESTION NO. 2 Degeneracy of the generic code denotes the existence of A. multiple codons for a single amino acid. B. codons consisting of only two bases. C. base triplets that do not code for any amino acid. D. different systems in which a given trip let codes for different amino acids. E. codons that include one or more of the unusual bases. QUESTION NO. 3 Replication A. requires that a phosphodiester bond of the incoming dNTP be hydrolyzed in order to be added to the growing chain. B. uses 5' to 3' polymerase activity to synthesize one…