Which statement is false about ribonuclease (RNase)? a)RNase can be heat treated and regain its structure upon cooling. b) Heat-treated RNase rapidly renatures due to stable cystine S-S bonds. c) Temporarily denature RNase has broken disulphide bridges. d)RNase is a peptide that degrades RNA
Q: QUESTION 24 Which one below gives the best explanation of the differences between presbycusis and…
A: Introduction : Presbycusis is a type of hearing loss that occurs as a natural part of the aging…
Q: The order is for Dilantin 200 mg, PO, qd. You have on hand Dilantin 250 mg per 5 ml. How many…
A: To calculate the required milliliters, we need to use the following formula: (Number of milligrams…
Q: Write explanatory notes on the contribution of increasing domestication and the global trade of…
A: Introduction: There are several types of infections, including: Bacterial infections: These are…
Q: 1. Discuss the following statement briefly: Eutrophication can be a natural process 2. What is the…
A: Ecology: Ecology is the scientific study of the relationships between living organisms and their…
Q: Explain how proteins are targeted to the ER, mitochondria, chloroplasts, and peroxisomes.
A: Introduction Proteins are complex macromolecules that play critical roles in the structure,…
Q: Match each example of mutation to the correct effect on function. Hypomorphic mutation Hypermorphic…
A: Introduction Mutation is a change in the genetic material (DNA) of an organism. It can be a change…
Q: Describe at least three physical mechanisms that are part of the first line of defense.
A: Introduction :- BODILY FLUIDS: are used to absorb and remove germs. Tears, saliva, urine, vaginal…
Q: Which of the following does an animal acquire through diet? (select all that apply) essential…
A: A diet is the sum of all the food and drinks that a person or animal consumes regularly. It refers…
Q: Question 11 (Population/Quantitative Genetics) A (dominant) and a (recessive) are alleles whose…
A: Hardy Weinberg equation describes the distribution of alleles in a population. This equation applies…
Q: Peroxisomes will convert acetaldehyde using_______NAD+ Molecules
A: Introduction Peroxisomes are small, membrane-bound organelles found in the cytoplasm of eukaryotic…
Q: Please watch this video and answer the questions. What is a Tagine (it is more than one thing)?…
A: Nutrition is the study of how nutrients in food are processed, absorbed, and utilized by the body…
Q: DNA polymerases have exonuclease activity that hydrolyzes DNA in the 3′ to 5′ direction. When an…
A: DNA POLYMERASE: DNA polymerase is an enzyme that plays a key role in the replication of DNA, the…
Q: 4. Which of the following mutations would be silent, missense, nonsense, or frameshift? The original…
A: The mutation is a sudden, stable, and heritable change in the organism’s genome. It can occur due to…
Q: Mature synapses distinguished from embryonic synapse by their a) longer postsynaptic potentials. b)…
A: Introduction: Embryonic refers to the earliest stages of development in an organism, from…
Q: The sliding clamp proteins are also known as PCNA. true or false?
A: Replication of DNA is a biological process that happens in living organisms and it is important for…
Q: In mice, yellow fur is dominant to brown fur, and the Yellow allele is a dominant mutation.…
A: A dominant mutation is a genetic mutation that causes a different phenotype when only one copy of…
Q: M Question: If you perform a Chi-square goodness of fit test, what is the value of Chi square X²…
A: Chi-square Goodness of Fit is a statistical test that allows us to compare observed data with…
Q: elect all examples of mutations that are likely to e dominant to wild-type alleles. elect all…
A: Dominant mutations are those mutations which are either present in the homozygous or heterozygous…
Q: construct a casual loop diagram for the norovirus linked to raw oysters from british colombia using…
A: Norovirus: Norovirus is a highly contagious virus that causes gastroenteritis or inflammation of the…
Q: Look at the label for Lindt chocolate bar below. a.) Does this product contain animal fat? How can…
A: Animal fat is a common ingredient in many types of food. It is typically derived from the adipose…
Q: One of the effects of climate change on ecological communities is the disruption of seasonal timing…
A: Narrow-sense heritability is a measure of how much phenotypic variation in a trait can be attributed…
Q: 5. Draw the reaction curve for the follow a) A reaction with an activation energy (EA) = 50 and free…
A: Activation energy (EA) and ΔG (change in Gibbs free energy) are both important factors that…
Q: There are skin illnesses that look different on Caucasian and on some other race's skin. 1) Find…
A: Introduction Skin is the largest organ of the human body and is composed of several layers of…
Q: Which of the following are binding/architectural proteins in the nucleus? a) U1 and U3 and…
A: Nucleus is one of the most important organelle of an eukaryotic cell. It is so because it contains…
Q: What are the nursing responsibilities pre procedure in CT scan?
A: As a nursing professional, the following are some of the key responsibilities that you should…
Q: The fraternal birth order effect, in which the number of brothers a boy's mother carried before him…
A: Introduction Birth order refers to the position of a child in a family relative to their siblings.…
Q: What would be the correct response of the myogenic mechanism to regulate glomerular filtration rate…
A: Maintaining a proper glomerular filtration rate (GFR) is necessary because it ensures the nephrons…
Q: Which family of guidance proteins contains both diffusible and contact guidance molecules? a) CAMS…
A: Introduction : Guidance proteins are a diverse group of signaling molecules that guide the growth,…
Q: The following two genotypes are crossed: AaBbCcdd x AabbCcDd. What will the proportion of the…
A: Genotype refers to the genetic makeup of an organism, which determines its inherited traits.…
Q: 5'-GCGGTACGTTACGGCTTTACTGACCTGCAGGC-3' A. Convert this to a double strand DNA molecule by writing…
A: Introduction - The DNA molecule separates, into two strands. Each strand serves as a(an) template,…
Q: How do I describe evolution of genesv represented by protein sequences?
A: Genes are segments of DNA that contain the instructions for building and maintaining an organism.…
Q: 4. Compare and contrast the mechanism used by competitive and noncompetitive enzyme inhibitors.…
A: Enzyme inhibitors are molecules that can bind to enzymes and decrease or block their activity.…
Q: 3. Name and describe the five steps of viral replication. Which step or steps differ the most…
A: Introduction :- Replication refers to the process of making a copy or a duplicate of something, such…
Q: True or False? With age, the walls of the arteries become more elastic, making it harder to maintain…
A: Arteries are the blood vessels that carry blood away from the heart. Its walls are quite elastic.…
Q: The following conditions are given below in leukocyte counting. Will it be increased or decreased?…
A: The following conditions are given below in leukocyte counting, and whether they would cause an…
Q: The introductory passage describes the identification of eukaryotic signature genes in…
A: Defining life can be challenging, as there are many different characteristics and properties that…
Q: What is needed for a T cell to progress from pro- to pre-T cell
A: T cells develop through a complicated process of differentiation and maturation from hematopoietic…
Q: So the correct answer is hydrogen bonds?
A: Protein structure is fundamental to understanding the function of proteins in biological systems.…
Q: Name one way other that a protein synthesized in the cytosol might then be targeted to the plasma…
A: Introduction: The cytosol, also known as the cytoplasmic matrix, is the fluid that fills the cell…
Q: A 28-year-old soldier stationed in the Middle East notices a 0.5-cm papule on his right forearm.…
A: Given that A 28 year old soldier in the Middle East notices a 0.5cm papule on his right forearm.…
Q: Miya fell in the playground and a splinter got stuck in her arm. Describe in your own words and in…
A: Introduction The immune system is a complex network of cells, tissues, organs, and molecules that…
Q: 5. Consider the process of transformation. Describe the process in terms of the cell that donates…
A: The technique of horizontal gene transfer known as bacterial transformation allows some bacteria to…
Q: 56-year-old woman is brought to the emergency department because of substernal chest pain and…
A: Introduction: A non-invasive examination called an ECG is used to track the electrical activity of…
Q: How is ATP produced in chloroplasts?
A: Introduction Chloroplasts are organelles found in plant cells and some other eukaryotic organisms,…
Q: 5' AGGCC TAAGTTCCCTCACACACACAGGG 3' 3¹ TCCGGATTCAAGGGAGTGTGTGTGTGCCC 5' B a mutation in an exon can…
A: Genes are hereditary structures on genetic material. These control some specific particular traits.…
Q: The spotted hyena can generate enough force with its jaws to crush bone. Which of the following is…
A: Introduction Bone is a hard, dense tissue that makes up the skeleton of vertebrates, including…
Q: 3. Given that (P) purple is dominant to (p) white and (T) tall is dominant to (t) short. A cross…
A: A genetic cross is the mating of 2 organisms for the combination of their genetic material and the…
Q: What is DNA replication and how is it related to cell division?
A: DNA is the genetic material of the cell. The functional segments of DNA are known as genes and they…
Q: How would I be able to calculate alpha, beta, and gamma diversity from sites A, B and C?
A: Alpha, beta, and gamma diversity are biodiversity measures that provide information about the…
Q: Which of the following is not correct concerning plant xylem? The fluid (sap) in the xylem…
A: Xylem is a specialized vascular tissue in vascular plants that transports water and dissolved…
Give detailed Solution with explanation needed..(don't copy the answer any where)
Step by step
Solved in 2 steps
- What is the name of the process by which amino acids arelinked together in the correct order based on an RNA sequence?"Protein synthesis in bacterial cells usually starts with a" A. Alanine Residue B. Formylmethionine Residue C. Phenylalanine Residue D. Methionine ResidueProtein synthesis in bacterial cells usually starts with a: phenylalanine residue. alanine residue. methionine residue. formylmethionine residue.