Answer question 11 Which statement regarding DNA methylation and gene expression is FALSE?None of the options are correct (all are ture)DNA methylation patterns must be cleared out during meiosisPatterns of 5'CpG methylation can be maintained through cell divisionDNA methylation can change the ability of transcription factors to bind DNAHDAC is recruited to sites of DNA methylation

The first option which states that none of the given options are correct (that says all the given…

Answered: Which statement regarding DNA…

Science

Biology

Which statement regarding DNA methylation and gene expression is FALSE?

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter10: Control Of Gene Expression

Section: Chapter Questions

Problem 15SA: Match the terms with the most suitable description. ___ methylation a. makes a man out of you ___...

See similar textbooks

Related questions

Q: an human is born with 45 chromosomes, what type of mutation occurred within this individual?

A: Human beings have 22 pairs of autosomal chromosomes and 1 pair of sexual chromosomes. Autosomes…

Q: What mutations affect phenotype?

A: Alteration in the DNA sequence of the cell is known as a mutation. Various types of mutations found…

Q: What is the genetic premises

A: A scientific premise can be defined as the knowledge that is gained based on the hypothesis and…

Q: Several Types of Genetic Variants Occur?

A: Genetic variation is phenomenon of change in the DNA sequence of genome in a constraint individual…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: Genes that cause cancer are called _____________.

A: Cancer means uncontrol cell proliferation and division in the body. This uncontrolled group of cell…

Q: How Are Human Genetic Disorders Inherited?

A: Genetic disorders are caused due to one or many abnormalities in the genome, this is mainly caused…

Q: In cancer like disease, what kind of mutations are more focussed? Single Nucleotide Polymorphism or…

A: Introduction Cancer is well known disease now a day. In US, 1 in 2 women and 1 in 3 men develops…

Q: Define about the DNA methylation ?

A: DNA (deoxyribonucleic acid) is the hereditary or genetic material present in most of the living…

Q: Why do mutations in DNA repair genes increase the likelihood of developing cancer?

A: Deoxyribonucleic acid (DNA) is a hereditary molecule that transfers genetic information from one…

Q: How might a mutation in the DNA result in the formation of cancer ?

A: The mutation is any change or alteration in the nucleotide sequence of the DNA. The mutation of a…

Q: A new mutation that occurs in which type of cell can be passed | on to offspring?

A: The mutation in egg cell or sperm cell can be passed to the offspring If a mutation that occur in…

Q: Why Many Inherited Diseases Result from Multiple Genetic Defects?

A: Genetic disorders : When health problems caused by abnormalities in genome. Abnormalities occur due…

Q: When DNA methylation takes place ?

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: A subset of colorectal cancers is associated with mutations in the Mut genes which code for proteins…

A: There are some Mut enzymes that check the identity of newly formed DNA and if there are certain…

Q: Why do gene mutations not result in chromosomal mutations?

A: Answer: Introduction: Mutation- These are the random heritable changes that occurs in the DNA…

Q: What are The Effects of Mutations on Gene Expression?

A: Mutation are the changes in nucleotide sequences. There are different types of mutations such as -…

Q: What causes extra chromosomes?

A: Chromosomes are long thread like structures present in the nucleus of all the cells. They carry…

Q: Describe how DNA methylation is heritable.

A: DNA (deoxyribonucleic acid) methylation involves the addition of methyl groups to cytosine bases…

Q: A homeotic mutation is one in which?

A: Any group of genes that control the pattern of body formation during the early embryonic development…

Q: Define the relation between DNA Methylation and Cancer ?

A: Cancer is a disorder caused by uncontrolled cell division.

Q: What is an extrachromosomal piece of DNA?

A: DNA is the genetic material and is packed into chromatin with help of packaging proteins. DNA and…

Q: Explain about the Cancer-causing gene formed by a mutation in a proto-oncogene ?

A: In genetics, the mutation is defined as the changes or alteration in the DNA sequences which result…

Q: What genes are involved in cancer?

A: Genes Involved In Cancer --- Genes and Their Characteristics -- Genes are made up of pieces of DNA…

Q: How is DNA methylation related to cancer?

A: The alteration to the structure of chromatin affects the gene expression, which is known as…

Q: When & how genetic expression occurs ?

A: Genetic expression is the process in which the transfer of information occurs from DNA to proteins.…

Q: Which is the biological molecule that contains the genetic information that is transmitted…

A: The genome of an organism is defined as the whole genetic information that is inherited from one…

Q: Are mutations good or bad? Explain your response to this question.

A: Any alteration in the sequence of deoxyribonucleic acid (DNA) is called a mutation. It occurs…

Q: Do Changes in DNA cause Increased Cancer Risk ?

A: The growth of new cells and also the breaking down of the old cells generally occur by a systemic…

Q: Which mutation, if it occurred in an individual’s mother, could be passed on to her child?

A: The type of mutation which is passed on to the child from their parents is called a hereditary…

Q: Which of the following statament is NOT TRUE about gene expression?

A: Central dogma consists of replication, transcription and translation.Replication is the process of…

Q: Are de novo mutations passed on?How many de novo gene mutations does the average person have?

A: De novo mutation is a genetic alteration that is present for the first time in a family member. It…

Q: Why the neutral mutations affect gene products?

A: Introduction :- A mutation is a change to an organism's DNA sequence. Errors in DNA replication…

Q: WHAT IS THE IMPORTANCE OF GENE EXPRESSION DURING DIFFERENTIATION?

Q: What is DNA methylation?

A: DNA is the component of chromosome contains proteins which form the chromosomal structure.

Q: Mutations must occur in which cells of the parent to be inherited by their offspring?

A: The cell is the essential underlying, utilitarian, and natural unit of every single known living…

Q: What is a tumor suppressor? What is an oncogene?

A: Cancer is a diseased condition where the cells show abnormal growth and proliferation. The cancerous…

Q: Will cells from your liver and your brain have the same DNA fingerprint? Explain.

A: DNA fingerprinting in genetics is method is method of isolating and identifying a variable elements…

Q: Explain the Gene Expression: From DNA to Phenotype ?

A: Gene expression is the process through which information from a gene is utilized in the synthesis of…

Q: "A deletion of a portion of a chromosome need not be very great before the effects become severe".…

A: The genetic material of a cell is a nucleic acid. Most of the organism has DNA as the genetic…

Q: When Replacement of the original gene occurs ?

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Q: How can mutations in noncoding segments of DNA contribute to the development of cancers?

A: The functions segment of hereditary material that mainly codes for the proteins is a gene. The…

Q: w would mutations in the Mut genes affect the DNA of an individual?

A: A Mutation happens once a deoxyribonucleic acid cistron is broken or modified in such how on alter…

Q: Which are the Genetic Basis of Cancers?

A: Cancer is a disease related to abnormal growth of cells where the cells have the potential to spread…

Q: Which type of mutation is responsible for new variations of a trait?

A: Any alteration in the sequence of DNA of a gene can cause changes in the resulting protein in such a…

Concept explainers

Learning and memory

Learning is defined as a relatively permanent and irreversible adaptive change in behavior. It always results from experience. The ability of an organism to store and recall the effects, sensations, and knowledge gained through learning and experience is called memory.

Question

Answer question 11

Which statement regarding DNA methylation and gene expression is FALSE?
None of the options are correct (all are ture)
DNA methylation patterns must be cleared out during meiosis
Patterns of 5'CpG methylation can be maintained through cell division
DNA methylation can change the ability of transcription factors to bind DNA
HDAC is recruited to sites of DNA methylation

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1 Correct Option: Option 1

VIEW

Step 2 Explanation:

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Any permanent change to the structure of DNA is considered a mutation. A somatic cell mutation affects only the individual organism, while a germline mutation is passed onto the next generation. For example, excessive amount of exposure to UV rays can lead to skin cancer. Although this type of mutation occurs in the somatic cells, every individual has different susceptibility to skin cell mutations upon exposure to UV rays. The susceptibility is located in the germ cell and is heritable. The individuals who choose to overexpose themselves to UV rays increase their likelihood of obtaining undesirable mutations in their somatic cells. Unlike suntanning, there are other activities we engage in that can lead to germline mutations. These activities should be avoided if possible as they lead to heritable mutations and cancer. Using 200 words or less, identify one human activity that can lead to a heritable mutation. Explain how it affects the individual and how it can be passed onto the…
Fruit flies with DNA transposons known as P elements are known to have 1.gene silencing factors in the cytoplasm 2.enhancers for specific genes 3.a certain chromatin conformation to enhance gene expression 4. more transcription factors to regulate gene expression
Mutagens are used to produce spontaneous mutations in a model organism. yes or no Somatic mutations can lead to mutant progeny. no or yes Significant expansion of a 3-base-pair repeat leads to Fragile X syndrome. yes no Chromosome translocations can occur in nonhomologous chromosomes. yes no
Which statement about transposons is INCORRECT? a.A transposon is a small fragment of DNA that can move from one location in a chromosome to another location in the same chromosome. b.Transposon insertion into a gene causes a mutation that can be reversed by removal of the transposon. c.Transposon movement often occurs when the cell is under genomic stress. d.In nature, insertion of a transposon can be deliberately added into a harmful gene to enhance survival.
Genomic imprinting refers to the inheritance of: Question 16 options: Gamete specific DNA methylating marks during meiosis. All epigenetic marks during mitosis. DNA methylating marks during mitosis. All epigenetic marks during meiosis. Gamete specific DNA methylating marks during mitosis.
Edward’s syndrome in humans (trisomy 18) is characterized by which genetic feature? it involves a duplication of the entire genome it involves a deletion of one chromosome it involves a deletion of one gene it involves a duplication of one gene it involves a duplication of one chromosome
Genomic imprinting refers to the fact that A. some proteins are made from mRNA transcribed by the mother B. one cell type follows the developmental path of another C. the X-ray repair system is inactivated D. programmed cell death occurs E. gene activity depends upon whether the gene is of maternal or paternal origin
Do not copy, answer fast and give type answer only Thanks a lot Which of the following is wrong for the description of protein synthesis(A) The large ribosomal subunit is constructed by proteins and ribosomal RNAs. (B) tRNA is necessary for protein synthesis.(C) DNA components are required.(D) GTP is required for the process. Alleles segregate independently of other alleles because:(A) Maternal and paternal chromosomes line up on the either side of the equator during metaphase I.(B) Crossing over in prophase I.(C) Separation of homologous chromosomes in anaphase I.(D) A and B(E) A and C Which statement is wrong for the transcription factors?(A)They can bind to the region out of the promoter.(B)They have two domains, one that binds DNA and the other that activates transcription. (C)Their functions are limited for transcription.(D)They can bind to activators. which statement about biotech is wrong? (A)DNA microarray assay can detect gene expression (B)RT-PCR cannot detect gene…
Which of the following types of epigenetic changes may promote cancer?a. DNA methylationb. Covalent modification of histonesc. Chromatin remodelingd. All of the above
Cystic fibrosis is a recessive disease that affects many parts of the body, but primarily presents itself through difficulty breathing and through cysts in the pancreas. It is caused by mutations in the gene CFTR. What chromosome is the gene on?
The protein that ensures the fidelity of DNA replication is the a. tumor repressor P53 protein. b. Mitotic arrest deficient protein. c. transcription factor E2F protein. d. Ataxia telangiectasia mutated protein.
In mammals, individuals with two X chromosomes usually de-activate one of the X chromosomes inside most of the organism's clls. The de-activated X chromosome is called a Barr body, and almost no transcription occurs from it. You would expect the Barr body to be composed of 1.) euchromatin 2.) RNA 3.) heterochromatin 4.) single-stranded DNA