Write down the levels of ecosystem organization from smallest to largest, next to its' description. a single organism a. b. - all the same species living in the same area - all the population of different species living in the same area С. d. includes the living organisms and nonliving aspects of an area - a large area with characteristic climate and organisms. e. f. part of planet with living organism
Q: economic and ecological significance of Barley (Hordeum)
A:
Q: Give economic and ecological significance of Corn (Zea)
A: Zea It is commonly known as corn. It is a cereal grain. The plant has a leafy stalk which have…
Q: cycle was thể first etabolic cycle to be Vered, predating the description of the citric cle by 5…
A: Urea cycle began inside the mitochondria of liver hepatocytes but three of the steps occur in the…
Q: Urinary system lab assignment and related case study Leo, 37-years old was absolutely shocked when…
A: Introduction The kidneys, ureters, bladder, and urethra make up the urinary system, often known as…
Q: He then ran the sample on an agarose gel and observed a strong band at approximately 400bp. What…
A: The band represent a small piece of DNA that was cut with restriction endonuclease and then…
Q: Assignment in Modules 4-6 Matching Type: Match Column A with Column B. Type the answer before the…
A: When the body fails to carry out the normal metabolic functions due to rare genetic conditions it…
Q: The first step in the formation of urine is formation of filtrate that accumulates in Bowman's…
A: The process of urine formation is done in the nephrons present in the kidneys. The nephrons are…
Q: Yeast cells has been cultured on glucose (Table 1). The growth data follows the Monod Equation Table…
A: I gave you the answers below. Thank you.
Q: A heart microslide demonstrates cells in the shape of pale chords, wh have few myofibrilla, glycogen…
A: The heart is a muscular organ that is essential for pumping blood and supplying nutrients, and…
Q: F E D H 1-09 G H life cycle life cycle A C B
A: Virus is a minute entity just like other microbe but have small size. It has dua nature . It behave…
Q: You are examining a set of genes from a phage that are transcribed late in infection. You know that…
A: This question is about gene.
Q: ANSWER THE SAME ANSWER ANYMORE. PLEASE INCLUDE REFERENCES I NEED IT. MAKE IT DETAILED IN ONE…
A: Endometrial polyp is abnormal growth after menopause in uterus. But also present unusually in young…
Q: What is the main reason for archiving your phage? so that you could repeat the DNA isolation (for…
A: The answer is to store your phage long term so that anyone who accesses the phage database could…
Q: Give economic and ecological significance of Oats (Avena)
A: Introduction Oats (Avena):- The oat, sometimes called the common oat, is a domesticated cereal grass…
Q: Bioassay with Spirogyra and bacteria, pigments, photosynthetics T. W. Engelmann (1882) filament of…
A: Photosynthesis is the process that occurs in the presence of sunlight.
Q: Substance that moves the electrical field solely depends on the speed of the substance in the…
A: 1. Substance that moves the electrical field solely depends on the speed of the substance in the…
Q: of
A: The main purpose to do homogenization of the milk is to break the large fat globules and then create…
Q: What is the significance of Juxtaglomerular apparatus in kidney function.
A: Introduction - The kidneys are two bean-shaped organs located on either side of your spine, below…
Q: , differentiate the effect of two varying pH levels (as indicated by by the color) to the amylase…
A: It is an enzyme which is produced by salivary glands and it have seen hydrolysis and digestion of…
Q: Enumerate primary organ rudiments that have started to take form in the 24 – hour chick embryo…
A: Introduction A multicellular organism's embryo is the first stage of development. Embryonic…
Q: Question z Methanogens are always engaged in relationships with other microbes because methane…
A: Answer- interspecies hydrogen Transfer. Interspecies hydrogen transfer (IHT) is a form of…
Q: Create an artwork portraying the prokaryotic cell (one for archaea and one for bacteria). Explain…
A: Both Archaea and Bacteria are unicellular organisms. In this way they are different from eukaryotes,…
Q: Explain in detail the process of making beer with process flow diagram.
A:
Q: describe the mechanics of breathing (quiet and forced)
A: In order to provide oxygen to the tissues and remove carbon dioxide from the blood, the actions of…
Q: Large caliber arteries during systole stretch and return to the baseline during diastole, ensuring…
A: Due to pulsatile flow of blood, the mechanical stretch in the blood vessel called arteries is mostly…
Q: BLASTP helps to predict the function of phage proteins by finding the e-value of phage proteins O…
A: ANSWER) (a) finding the e-value of phage proteins The BLASTp helps to predict the function of phage…
Q: Describe the process of Translation of mRNA to DNA.
A: Ribonucleic acid (RNA) can be described as a chemical present in a wide range of living creatures,…
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: The walls of vessels have rather significant morphological differences in the structure of the…
A: The three major types of blood vessels are arteries, veins and capillaries. Arteries carry…
Q: Jim hasn't been having success in growing strawberry plants for the past few years, so he got his…
A: The observation of the following experiment conducted by Jim is there is some problem with the soil…
Q: A Moving to another question will save this response. Question 9 Which of the following statements…
A: When considering workout for weight loss or muscle gain, it's a better idea to be consistent and…
Q: 5) cranial nerve II, the optic nerve sends nerve impulses to the brain carrying information about…
A: It is critical to learn and know the anatomy and physiology of the human body. Many changes in the…
Q: Describe the behavioural and physiological adaptations that enable many rodents to thrive in arid…
A: Introduction "Adaptation is a physical or behavioural trait of an organism that aids in the…
Q: 8. Describe the MAP kinase activation pathway
A: Protein kinases and other messenger systems form highly interactive networks to achieve the…
Q: The normal flow of electrons through the electron transport chain is blocked by sodium azide. Which…
A: The citric acid cycle and electron transport chain is the aerobic stages of cellular respiration.
Q: GUIDE QUESTIONS: 1. Identify the fixation and embedding protocols of seed tissues for microtome…
A: Microscopes are extremely significant equipment that is mostly utilized in the field of science. The…
Q: The fact that muscles and skeletons work together to move the body from place to place is an example…
A: Living organisms exhibit life processes that are absent in nonliving objects.
Q: The carpel (pistil), the female reproductive organ of a flower, consisting of _______, ________ and…
A: sexual reproduction is the soil function of the flowers which are the showiest part of plant Flowers…
Q: Pick the best answer choice from below:
A: During oxidative phosphorylation a total 2.5+1.5=4 molecules of ATP produced in one round. The NADH…
Q: Differentiate concentrates from roughages and compare its utilization in animal feeding.
A: Animal nutrition is critical for animal health and welfare, as well as the production of safe and…
Q: Which of the following signs is most often observed in acute and chronic alcoholism? OA. Barret…
A: Alcohol poisoning is a condition caused by the rapid and excessive consumption of alcoholic…
Q: 4. 16B (Eukaryotes): Describe 4 factors that differentiate eukaryotic chromosomes/genome from a…
A: Nucleus is a chief controller of the cell which carries genetic instructions . It comprises of…
Q: Describe the process of Translation of MRNA to DNA.
A: The process of the process from a DNA strand into a new RNA ( mRNA ) molecule is known as…
Q: Question 25 Which of the following RNAS is the product of transcription? A MRNA and tRNA only B FRNA…
A: Answer: D) mRNA, tRNA and rRNA. The product of DNA transcription is RNA it can be in the form of…
Q: Question 4 of 25 Use the diagram to answer the question. Some organisms use a single loop…
A: The single loop heart is found in lower organisms (fish), in which the blood pressure and oxygen…
Q: Ant species work together to collect food and build the mounds they live within. This behavior…
A: Ants are distributed in all different habitats and everywhere on the planet but less in Antarctica,…
Q: Question: Match the following terms with their meanings from the drop down menus. Water potential…
A: Introduction Cell transports are the movement of a substance through the cell membrane. The…
Q: Describe the differences between 'top down' and 'bottom up' proteomics? Under which conditions would…
A: Proteomics has large scale investigation for proteins. Proteins are important portions of living…
Q: (Select one answer from dropdown menu and fill in the blanks:) When a sperm and an egg cell called a…
A: The mechanisms that work to stimulate or suppress the transcription of a gene are referred to as…
Q: Assignment in Modules 4-6 Matching Type: Match Column A with Column B. Type the answer before the…
A: 1) phenylketonuria is the genetic defect in which the child is unble to breakdown the protein called…
Step by step
Solved in 2 steps
- Given a hierarchy of ecological systems, indicate what attributes will be of interest toyou at each level as an ecologist. Provide a reason for each answer.i. Ecosystemii. Landscapeiii. Biomeiv. BiosphereWhichstatement about organisms’ “niches” is false?a.The niche summarizes environmental factors influencing growth, survival,and reproduction of a species.b.The niche concept was developed by Joseph Grinnell and Charles Elton.c.The “fundamental” niche refers to physical, but notbiological, aspects of the environment.d.Interactions such as competition and parasitism may restrict the size ofan organism’s niche.e.In the laboratory, two species with identical niches are especially easyto maintain in a mixed culture.Which of the following is a consequence of biologicalmagnification?(A) Toxic chemicals in the environment pose greater risk totop-level predators than to primary consumers.(B) Populations of top-level predators are generally smallerthan populations of primary consumers.(C) The biomass of producers in an ecosystem is generallyhigher than the biomass of primary consumers.(D) Only a small portion of the energy captured by producersis transferred to consumers.
- What is the difference between a community and an ecosystem? Group of answer choices a. an ecosystem includes the abiotic environment b. a community includes the abiotic environment c. they are exactly the same thing d. an ecosystem covers a larger geographic area e. a community covers a larger geographic areagiven a hierarchy of ecological system, indicate what attribute will be of interest to you at each level of ecologist . provide reason for each answer. a.individual b.population. c.community d.ecosystem e.landscape. f.biome. g.biosphere.Of the following statements about protected areas that havebeen established to preserve biodiversity, which one is notcorrect?(A) About 25% of Earth’s land area is now protected.(B) National parks are one of many types of protected areas.(C) Management of a protected area should be coordinatedwith management of the land surrounding the area.(D) It is especially important to protect biodiversity hot spots
- Ecosystems include which of the following components that communities do not?a. energy transfer between membersb. interaction with the physical environmentc. intricate food websd. herbivores and carnivoresThe major factors that make up the environment/ecosystems is/are? a. physical and chemical factors b. chemical c. biological d. physical, chemical and biologicalThehighest level of ecological organization focuses on:a.the gene.b.the biosphere.c.warbler use of trees.d.forests.e.none of the choices apply
- Match the term with its corresponding definition by using the drop-down menu. Community Ecosystem Population Habitat Species A. A group of populations living and interacting with each other in an area B. A group of organisms of the same species living in the same area at the same time C. A community and its abiotic (non-living) environment D. The environment in which a species normally lives E. A group of organisms that can interbreed to produce fertile offspringWhich of the following statements about ecology is correct? CHECK ALL THAT COULD BE CORRECT A)Ecological studies may involve the use of models and computers. B)Ecology is the study of the interactions between biotic and abiotic aspects of the environment. C)Ecology is a discipline that never considers natural selection and evolutionary history D)Ecologists may study populations and communities of organisms. E)Ecology spans increasingly comprehensive levels of organization, from individuals to ecosystems.The biosphere is (a) all organisms on Earth, together with their physical environments. (b) crucial to human survival and well-being. (c) a source of food and raw materials for human society. (d) a web of interconnected ecosystems. (e) all of the above