Q: A classical experiment studying the fate determination of stem cells in the developing embryo uses…
A: Answer :- Option ( D) is correct. - The organs arising from quail somites develop in the reverse…
Q: Explain the following in paragraph form consists of at least five sentences for each question.…
A: Hermaphroditism is the process in which both the types of reproductive organs are present in the…
Q: This is about ecological sampling methods in estimating plant cover. Define the following: cover,…
A: Plant cover in ecology is used to measure the abundance of plant species in a relative area covered…
Q: What are the physiological changes that can occur when an individual adds resistance training to…
A: Introduction Resistance training is any exercise that causes the muscles to contract against an…
Q: What function do the malleus, incus, and stapes bones in the inner ear play in processing sounds?…
A: The malleus, incus, and stapes bones also known as auditory ossicles . Present in the Inner ear .…
Q: Observation
A: The monosomies , trisomies and other type of chromosomal abnormalities mainly affects the chromosome…
Q: ou count 54 colonies of bacteria on an agarp late on which you spread 0.2ml of a 10^-4 (or 1/10,000)…
A: Given information No. of colonies= 54 Volume = 0.2 ml Dilution = 1/10000
Q: Ascaris lumbricoides, I.s. Illustrate the stages of mitosis, as seen under HPO. Label the stages…
A: Answer :: Cell division:- Cell division happens when a parent cell divides into two or more…
Q: Describe how digestion is controlled by the nervous system and hormones.
A: Answer
Q: Which form of flavin adenine dinucleotide is the "reduced" form, FAD or FADH2? Explain
A: Flavin Adenine Dinucleotide: It is a redox active coenzyme associated with various proteins, which…
Q: estrogen receptor (ER)-positive or -negative.
A: Cancer : The condition where the cells in a specific part of the body grow and reproduce…
Q: Which of the following statements is FALSE? Toxicity is most likely to happen when taking daily…
A: A vitamin is essentially an organic material (or a group of molecules chemically linked, i.e.…
Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…
A: If template sequence of the DNA is A.. mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA
Q: What are the principle and basic concepts of DIFFERENTIAL staining?
A: The simple dye is used in the technique of simple staining to highlight only the specific structures…
Q: adaptive immune response
A: Immunity : The ability of the host to fight against the disease causing organism i.e., pathogen…
Q: senescence
A: Definition of Senescence: The process of gradual eradication of functional characteristics in living…
Q: What are the principle and basic concepts of NEGATIVE staining?
A: Introduction Staining is a technique for enhancing contrast in material, usually on a microscopic…
Q: What is the main reason for archiving your phage? so that you could repeat the DNA isolation (for…
A: The answer is to store your phage long term so that anyone who accesses the phage database could…
Q: Styles raph Lungfishes Amphibians Mammals Tetrapod limbs Lizards and snakes Amnion Crocodiles…
A: A tree like or comb like taxonomic relationship among different group of organisms is called…
Q: Upon what principle does bactofugation depend? Why might its use be desirable in processing milk…
A: Bactofugation is a centrifugal method for eliminating microbe spores from milk, particularly when…
Q: 1. Bioinformatics analyses of the genomes of cancer cells from many different patients with…
A: Introduction Cancer is a disease in which some cells in the body grow out of control and spread to…
Q: Match the letter to the appropriate bone. Im A d Im
A: Introduction:- The core framework of body is the skeletal system.It is composed of bones as well as…
Q: Why is reprouctive isolation insuffecient to define a species?
A: Reproductive isolation refers stopagge in the ability to reproduce successfully with sexual…
Q: When present, the TATA, CAAT and GC boxes are typically found within 100 - 150 bp upstream from the…
A: The TATA box is a conserved nucleotide sequence located around 25-30 base pairs upstream of the…
Q: Which of the following images shows a phage with a Siphoviridae morphotype? A) B) C)
A: Siphoviridae viruses are double stranded DNA viruses which belong to order Caudovirales. this family…
Q: In case of a plant virus going viral, what actions do you think should be made to improve our food…
A:
Q: Please help Why did we use nanoparticles?
A: Nanoparticles are the techniques which are used in the biotechnology which used to identify the gene…
Q: what is the current population of hawks?
A: Hawks (family Accipitridae) are one of the major groups of predatory birds that are active during…
Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…
A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…
Q: Directions: Based on the analogy of light reactions. Describe the pattern of the electron flow…
A: The initial phase of photosynthesis is the light reaction, that converts sunlight into chemical…
Q: Septic shock is life - threatening condition caused by an overwhelming
A: Septic shock- it is a condition sometimes occurs in severe sepsis, in which the blood pressure…
Q: The ff. mothers, (A) through (E) with given phenotypes, each produced one child whose phenotype is…
A: This question can be done by splitting each trait and crossing the concerned trait of mother and…
Q: Explain the signaling steps that take place after the EGF receptor is dimerized, up to the poiunt…
A: As per our company guideline we are supposed to answer only first question or only first 3 subparts…
Q: Besides the Warrior gene, the only other genetic mutation directly correlated with “super-maleness”…
A: As mentioned in many scientific literature the warrior gene which is normally referred to as MAOA…
Q: During a crossover event, more nonrecombinant than recombinant gametes will be produced. O True O…
A: Introduction Crossing over refers to the exchange of DNA between paired homologous chromosomes that…
Q: A sealed greenhouse that allows sunlight through the windows but prevents water or vegetation from…
A: A greenhouse is a self-designed structure having walls and roofs made up of transparent materials…
Q: 9. Suppose you accidentally introduce a small plant-eating beetle into your self-contained…
A: You construct a self-contained ecosystem in a jar, following some instructions. Your ecosystem…
Q: 2. An ecologist spent a year studying the population dynamics of a species of duck on a lake. At the…
A: Firstly let's understand what's migration, immigration and emigration. MIGRATION: In ecology,…
Q: What does the color of Leo’s urine tell you about how concentrated or diluted it is? What about his…
A: 1.Before exercise leo is well hydrated because his urine color is pale yellow this is also supported…
Q: which protein interacts with RNA polymerase, in order to allow RNA polymerase to cleave RNA using…
A: SII a protein, interacts with RNA polymerase, in order to allo RNA polymerase (ll mainly) to cleave…
Q: design a bacterial/archaeal species, what would be its characteristics (e.g. shape, arrangement,…
A: Bacteria are small unicellular microorganism that lacks any proper cell organization (which means no…
Q: What is biomass
A: Biomass is defined as the total quantity of plants in a particular area.
Q: What made the angiosperms the most successful terrestrial plants? Discuss your answer.
A: Answer Angiosperms are the most dominant form of plant life in most terrestrial ecosystem.
Q: 10. In class we discussed 3 types of plant and animal defenses (not mimicry), name one and give an…
A: Plants represent a rich source of nutrients for many organisms including bacteria, fungi, protists,…
Q: 2
A: The ovary is part of the female reproductive system. It is an organ that has ova (eggs). These ova…
Q: Essay on Circulatory system
A: Introduction The heart, blood vessels, and blood are all part of the blood circulatory system, which…
Q: The distinction between SLA and HDD may be explained as follows:
A: Disease It is a particular abnormal condition that negativity affects the structure or function of…
Q: UCAQ UC AG UGA0 UC UCAG GUC UOPO AC Alanine Tyrosine Stop A GU Valine Y Cysteine G A Stop AG AC A G…
A: Genetic Code The genetic code is the relationship between the sequence of basis in DNA or its mRNA…
Q: Nonfunctional HexA protein is responsible for the autosomal recessive disease Tay Sachs. A patient…
A: Ans... a base substitution in an enhancer region
Q: Give economic and ecological significance of Corn (Zea)
A: Zea It is commonly known as corn. It is a cereal grain. The plant has a leafy stalk which have…
Give economic and ecological significance of Oats (Avena)
Step by step
Solved in 3 steps
