Write the cross using correct symbols. What kind of cross is this called? 2. In fruit flies:At the b locus, + = normal colorb = black bodyAt the v locus, + = normal wingv = vestigal wing1Expected****ObservedA cross between a female fly heterozygous for both traits and a black bodied male with vestigialwings is made.a. Write the cross using correct symbols. What kind of cross is this called?

The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Answered: Write the cross using correct symbols.…

Science

Biology

Write the cross using correct symbols. What kind of cross is this called?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter12: Mendel, Genes, And Inheritance

Section: Chapter Questions

Problem 1TYK: The dominant C allele of a gene that controls color in corn produces kernels with color; plants...

See similar textbooks

Related questions

Q: What is the importance of Carbonate/Bicarbonate buffer system for the oceans. What would happen if…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: .) Kerry's folate intake was low at 59% of the DRI. Why is this a concern? A.) she is a…

A: Answer : a) She is child bearing age female Reason : The risk of neural tube abnormalities in your…

Q: Autodock, Gold and Glide are other bioinformatics tools that are widely utilized by many researchers…

A: A technique called molecular docking examines how molecules are oriented and conformed within a…

Q: When a cell uses fats for aerobic cellular respiration, it first hydrolyzes (breaks down) fats to…

A: Introduction :- The process of cellular respiration that occurs in the presence of oxygen gas in…

Q: Overview of Cell Signaling Pathways Q7.2: A first messenger molecule activates a receptor that…

A: Cells receive and respond to signals from their surroundings. This is accomplished by a variety of…

Q: Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the…

A: Introduction Gene expression is the process through which a gene's information is used to create a…

Q: Plz answer this all questions What muscle in the shark is homologous with the geniohyoideus in…

A: The common mudpuppy is a species of the salamander belongs to the genus Necturus. They live an…

Q: Factions in our cells happen in a perfect way , therefore DNA replication is error free

A: Ans: DNA replication is defined as the process in which a double stranded DNA molecule is duplicated…

Q: Acetylcholine is a neurotransmitter that, when bound to its receptor, causes the receptor to open a…

Q: Consider the figure attached, showing seven people studied between point A and B, and where the…

A: Prevalence of an illness = Number of people in the sample with illness/Total number of people in the…

Q: WHO is Henry Lowe ? what what did he created?

A: Dr Henry Lowe was born on April 9, 1939. He is a scientist and businessman in the health industry.…

Q: In a saliva of the patient the contents of enzymes is reduced. What cells of secretory portion do…

A: Salivary glands are made up of secretory units also known as acini and ducts. Ducts are highly…

Q: Draw and label a 2n=4 cell going through anaphase II of meiosis.

A: Eukaryotic cells in advanced multicellular organisms undergo two types of cell divisions - mitosis…

Q: On October 29, the North Carolina Division of Public Health (NCDPH) received a report of three cases…

A: The p- value is a statistical measurement used to validate a hypothesis against the observed data.…

Q: To investigate the properties of cell membranes, a scientist used the Fluorescence Recovery After…

A: Specific light wavelengths stimulate fluorescent markers, which then emit light with a different…

Q: Name two traits that primates have that are modified from an ancestral mammalian form (consider:…

A: Primates usually come under mammalian order and is divided into two sub orders prosimians and…

Q: explain the usage of hypnotic drugs (sleeping pills). What kinds of medicines are utilized, as well…

A: 1. Sleeping pills or hypnotic drugs should only be taken when prescribed by doctor. They are used to…

Q: Which statement below best describes what these data might have demonstrated to Kornberg about the…

Q: Macmillan Learning Hominin is a group of species that includes modern humans and extinct human-like…

A: INTRODUCTION Primates : primates are mammal group including monkeys, apes and human.

Q: There are several lines of evidence that suggest that chloroplasts and mitochondria were once…

A: For performing independent life, energy production is very much important. Some organisms depend on…

Q: About how many carbon (14) beta decays occur in your body every minute?

A: Carbon 14 has a half life about 5730 years where it is reached at its 50%. 8 thousands atoms decay…

Q: Choose the statement that best describes the outcome of transfecting cells with a plasmid that…

A: A plasmid is an extra chromosomal DNA present within a cell. It is physically separated from the…

Q: A) Identify the structures that would be found in proteins B) identify the structures that…

A: Introduction Large biomolecules and macromolecules known as proteins are made up of one or more…

Q: 8.The arm is known as the ________ region; the neck is known as the ________ region.? a. otic;…

A: Introduction :- The network of nerves known as the brachial plexus transmits information from the…

Q: population of 100-200 individuals. The island population is descended from a few individuals that by…

Q: CROSS 1 2 3 4 ROOSTER walnut Walnut Walnut walnut CROSS 1 HEN Walnut Single 2 3 4 pea walnut What…

A: Given: In poultry, the shape of the comb may be rose (A_bb), pea (aaB_), walnut (A_B_), or single…

Q: The arm is known as the ________ region; the neck is known as the ________ region. a. otic; axillary…

A: We can say that The human body is complex machinery that is anatomically divided into three…

Q: Describe the importance of dietary sugars and lipids. In your answer, discuss in detail the impact…

A: Introduction A macromolecule, such as a protein or nucleic acid, is a very big molecule crucial to…

Q: The plasmids from the pUC series are created in the University of California. They carry a lacZ gene…

A: The pUC series plasmids have a lacZ gene that act as a selectable marker. The lacZ gene contains the…

Q: missing a name or two from the list (Enterobacter aerogenes), and (Serratia rubidaea)- should be 20…

A: Biochemical testing and staining procedures are used to identify bacteria. For example, in substrate…

Q: - Solve the following genetic problems with a Punnett square 1. An organism that shows a dominant…

A: Introduction : Genotypenis defined as the genetic information passed down from one generation to…

Q: How can we determine whether predation is controlling the size of a population? What are the…

A: There is basically inter specific competition type of interaction that exist between prey and…

Q: Use the survivorship curves (A, B, and C) shown on the graph below to answer the following three…

Q: What is the pathophysiologic basis for Ms. Rainwater's increased respiratory rate, blood pressure,…

A: Pathophysiology represent the abnormal physiological changes which represent a particular disease.…

Q: What is color opponency and how is it coded in the retina?

A: The human visual system decodes colour information by processing photoreceptor cell impulses in an…

Q: of three cases of hemolytic uremic syndrome (HUS) among children caused by Escherichia coli O157:H7…

A: Hemolytic uremic syndrome is life threatening sometimes. The symptoms are diarrhoea (bloody), fever,…

Q: During the colony selection at the end of the cloning step, there is a possibility of encountering…

A: During colony screening, false colonies in the plates hinder the selection process, which is…

Q: Which of the following components found in the bone matrix make bone somewhat flexible and…

Q: M13 is a filamentous phage that infects the bacterium Escherichia coli. Infection with M13 is not…

A: A vector is a living organism that transmits an infectious agent from an infected animal to another…

Q: Draw a pyramid of numbers using the following data: 480 phytoplankton, 900 zooplankton, 200 C.…

A: PYRAMID OF NUMBER- The number of distinct creatures present at each level of an ecosystem's food…

Q: BasH II Kpnl Dra TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT…

A: Many people agree that one of the 20th century's most significant contributions to molecular biology…

Q: The genomes of two E. coli strains are compared in Figure 14-19. Would you expect any third strain…

A: The availability of this genome sequence will aid in the identification of genes responsible for…

Q: There are different type of fixatives, classify those fixatives based on its COMPOSITION and ACTION…

A: Fixatives are the physical agents or chemical substances which are used to stabilize or preserve the…

Q: Is it possible to perform DNA profiling with SNPs instead of SSRs as DNA markers, but in general you…

A: SNPs are used by geneticists as markers to find genes in DNA sequences. Suppose a gene alteration…

Q: ANCOVA

A: The protective effect of E.farcium on s.typhimurium infection induced damage. This study compares…

Q: 13. The process of "cell drinking" is called: a. phagocytosis b. exocytosis c. pinocytosis d.…

A: 13 . c. pinocytosis reason : Pinocytosis: In this procedure, the organisms consume the liquid. It's…

Q: Describing characteristic what gave homo habilis it's name

A: The extinct species of human known as Homo habilis, sometimes known as "able man" or "handyman," was…

Q: F. How much of a 100 mg/mL stock of Ampicillin would you need to add to 400 mL for a 100 ug/mL final…

A: Given data:- Concentration of stock of ampicillin = C1 100mg/ml. Volume of stock solution required…

Q: 1) Using Punnett Squares, determine which genotypes are possible at each gene locus if you cross…

A: Mendelian inheritance describes specific patterns of how features are passed down from parents to…

Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…

A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…

Question

Write the cross using correct symbols. What kind of cross is this called?

2. In fruit flies:
At the b locus, + = normal color
b = black body
At the v locus, + = normal wing
v = vestigal wing
1
Expected
****
Observed
A cross between a female fly heterozygous for both traits and a black bodied male with vestigial
wings is made.
a. Write the cross using correct symbols. What kind of cross is this called?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Imagine you are performing a cross involving seed color in garden pea plants. What Fi offspring would you expect if you cross true-breeding parents with green seeds and yellow seeds? Yellow seed color is dominant over green. 100 percent yellow-green seeds 100 percent yellow seeds 50 percent yellow, 50 percent green seeds 25 percent green, 75 percent yellow seeds
The dominant C allele of a gene that controls color in corn produces kernels with color; plants homozygous for a recessive c allele of this gene have colorless or white kernels. What kinds of gametes, and in what proportions, would be produced by the plants in the following crosses? What seed color, and in what proportions, would be expected in the offspring of the crosses? a. CCCc b. Cccc c. CcCc
In addition to the two genes in problem 4, assume you now study a third independently assorting gene that has the alleles C and c. For each of the following genotypes, indicate what types of gametes will be produced: a. AA BB CC b. Aa BB Cc c. Aa BB cc d. Aa Bb Cc
In peas, the allele Le produces tall plants and the allele le produces dwarf plants. The Le allele is dominant to le. If a tall plant is crossed with a dwarf, the offspring are distributed about equally between tall and dwarf plants. What are the genotypes of the parents?
Another gene in Drosophila determines wing length. The dominant wild-type allele of this gene produces long wings; a recessive allele produces vestigial (short) wings. A female that is true- breeding for red eyes and long wings is mated with a male that has purple eyes and vestigial wings. F1 females are then crossed with purple-eyed, vestigial-winged males. From this second cross, a total of 600 offspring are obtained with the following combinations of traits: 252 with red eyes and long wings 276 with purple eyes and vestigial wings 42 with red eyes and vestigial wings 30 with purple eyes and long wings Are the genes linked, unlinked, or sex-linked? If they are linked, how many map units separate them on the chromosome?
The following pedigree shows the pattern of inheritance of red green color blindness in a family. Females are shown as circles and males as squares; the squares or circles of individuals affected by the trait are filled in red. What is the chance that a son of the third-generation female indicated by the arrow will be color-blind if the father is a normal man? If the father is color-blind?
7. In guinea pigs, black hair colour (B) is dominant and brown hair colour (b) is recessive. Long hair (L) is dominant and short hair (l) is recessive. Answer the following questions: (a) Diagram the cross: BbLl x BbLL (b) What are the phenotypes of the parent generation? (c) What are the genotypes and phenotypes of the F1 generation?
1. In a cross between a black and a white guinea pig, all members of the F1 generation are black. The F2 generation is made up of approximately 3/4 black and 1/4 white guinea pigs. (a) Diagram this cross, showing the genotypes and phenotypes. (b) What will the offspring be like if two F2 white guinea pigs are mated?
2.In dogs, there is a hereditary deafness caused by a recessive allele, d. A kennel owner has a male dog that she wants to use for breeding purposes if possible. The dog can hear, but the owner is unsure of the genotype. She does a testcross (crosses it to a homozygous recessive dog), and two of the five offspring are deaf. This means that the male dog A.has the genotype DD B.has the genotype Dd C.is still of unknown genotype since there were offspring of both deaf and hearing phenotypes. D.has the genotype dd
1. If a purebred pea plant with purple flowers was crossed with a purebred pea plant with white flowers, all of the offspring's flowers ended up being purple. In this instancethe WHITE flower trait is considered to be what?
1. A male fruit fly, heterozygous for both vestigial wings and ebony body, is crossed with a female homozygous for normal wings and heterozygous for ebony body. What fraction of their offspring will have normal wings and an ebony body?
4) In frost moths, two alleles of one gene determine the character difference of spotted versus striped wings and two alleles of a separate, independent gene determine the character difference of orange wing background versus white wing background. The results for four matings of moth phenotypes are shown in the image attached. a) Assign the letter “s” to the wing pattern gene and letter “w” to the background color gene. Write in the capital letter for the dominant phenotype and the lower case letter for the recessive phenotype. Also, write whether each allele is dominant (D) or recessive (R). Wing pattern gene: Spotted - letter assignment:____ - dominant or recessive:____ Striped - letter assignment:____ - dominant or recessive:____ Background color gene: orange: - letter assignment:____ - dominant or recessive:____ white: - letter assignment:____ - dominant or recessive:_____ b) Based on the four matings in Question 4: What are the genotypes of each parent in each cross? If more…