Write the effects of heroin on human body.

Q: Which coenzyme is not a Pyruvate Dehydrogenase Complex (PDH) requirement? O a. thiamine…

A: Introduction Coenzymes are non-proteinaceous substances that are essential for enzymes and increase…

Q: (i) Explain the effect of the ionising radiation on the bacteria. (ii) Identify the purpose of petri…

A: Given here is the effect of ionising radiation on the growth of salmonella typhimurium in the…

Q: Describe rubella and rubeola.

A: Rubella-  It is a viral infection which is also called German measles or three day measles. It is a…

Q: Why does puberty occur too late or too early in some individuals?

A: The body's normal process of sexual maturity is known as puberty. The hypothalamus, a small region…

Q: Which of the following is true about innate immune system? Check all that apply. Rig-I-like…

A: Innate Immune system It refers to the non-specific immunity that individuals are born with. It is…

Q: 9. Other than bacteria list the other 6 types of Microorganisms listed in your textbook.asap

A: Microorganisms or microbes are the microscopic organisms that exist as unicellular or multicellular…

Q: What is the function of hepatocytes?

A: Introduction The liver is the largest gland in the body and plays various important roles in human…

Q: Which of the following pairs correctly describes an example of antagonistic hormones that regulate…

A: Introduction The institution of glands that secrete chemical currier (hormones) is the endocrine…

Q: Changes in environmental conditions can render previous adaptations as maladaptations. Describe an…

A: A maladaptation is a trait that is more harmful than helpful in evolution, as opposed to an…

Q: Calculate the melting temperature of this primer and estimate the annealing temperature of this…

A: Introduction PCR (polymerase Chain Reaction) is a molecular technique by which multiple copies of…

Q: TRUE OR FALSE: • Digestive secretions from the ● small intestine complete the digestion of…

A: Introduction Digestion is a process in which the food that we consume moves through the digestive…

Q: A. Observe the frog ovary and take note of the following structures: theca interna, theca externa…

A: Ovary This is a reproductive hormone where eggs are formed. There are a pair of ovaries present in…

Q: Would you expect a desert annual (a drought escaper) to have high or low water use efficiency?…

A: Water use efficiency Efficiency is the ability to produce or receive an output with an minimum input…

Q: Describe the defect in intussusception.

A: Introduction The human digestive system comprises the alimentary canal and associated digestive…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: You start your 8-4 pm shift and review the quality control Levy Jennings chart results from the…

A: Issue :  This is an ethical problem. The Levey Jennings outline is a chart that portrays the quality…

Q: Which of the following species is prokaryotic? A. Mus muculus B. Arabidopsis thaliana C.…

A: Prokaryotes - these are the organisms whose cells lack a nucleus and other organelles. Prokaryotes…

Q: Compare renewable versus nonrenewable resources.

A: Introduction Ecological Footprint (EF) represents the demand of a person or a group of a person on…

Q: is a substance secreted by cells in the lungs that reduces surface tension.

A: Introduction :- The lungs are two air-filled, spongy organs that are situated on either side of the…

Q: 1. Determine the inactivation rate constant (K) for a microorganism for the following treated…

A: The inactivation of microorganisms in a disinfection plant is determined by the length of time the…

Q: What size circuit can be analyzed with circuit theory if the electrical energy exciting the circuit…

A: Circuit theory is the study of the behavior of electrical circuits. It can be used to analyze and…

Q: Label name only

A: We know that Teeth help us to chew food that would be large enough to swallow. Teeth also help us to…

Q: What is the pathophysiology of osteochondrosis?

A: Osteochondrosis is a degenerative disorder of the bone and cartilage that most commonly occurs in…

Q: Regions of NSW were recently impacted by increased populations of mice. Mice first reproduce from…

A: Warfarin is a drug used in chemical warfare during world war 2. This drug acts as anticoagulant and…

Q: According to the graphical theory of life history evolution, describe the shape of the trade-off…

A: A group of creatures that can breed with one another in nature and create healthy offspring is…

Q: identify which substrates are most compatible for L929 cell growth. Support answer with…

A: L929 is a fibroblast cell line derived from a clone of male C3H/Anmouse subcutaneous areolar and…

Q: what is the key aspect of development? a. growth b. lifespan approach c. progess d. evolution

A: Development is defined as the process of becoming bigger, stronger, better, etc. Development play…

Q: 54

A: We know that The anterior pituitary gland releases a peptide hormone known as prolactin. It helps in…

Q: TRUE OR FALSE: asap Digestive secretions from the small intestine complete the digestion of…

A: Digestion is the process by which large insoluble food molecules are broken down into small…

Q: Always begin examing microscope slides with which power objective?

A: A microscope is an instrument of immense importance in a biology/ microbiology laboratory. As the…

Q: Why does inflammation occur with contact dermatitis?

A: The clinical definition for skin inflammation is dermatitis (irritation). An allergic or irritating…

Q: T4

A: We know that The digestive system in humans is a long hollow tube that has an inlet (mouth) and an…

Q: Match the description with the correct term. the idea that different mating calls of birds used…

A: Introduction Evolution refers to the change of characteristics of a population that can be inherited…

Q: 12. In humans, the plasma comprises what percentage of the blood? a. 45 percent b. 55 percent c.…

A: We know that Blood is a fluid connective tissue composed of cellular parts like red blood cells…

Q: What causes the inflammation of acne vulgaris?

A: Acne vulgaris is a skin disorder. It has been seen on the face. Acne vulgaris is a chronic skin…

Q: QUESTION 18 Most of the human genetic diversity occurs: Within diverged genetic populations O…

A: Genetic differences aid the population's survival and evolution in a changing environment. The…

Q: Which of these discoveries were used by paleontologists to conclude that some hominins—Homo erectus,…

A: The species H. erectus is extremely diverse, which is not surprising given its long existence and…

Q: What are ribosomes? State the function of ribosomes. In what way eukaryotic ribosomes differ from…

A: A subfield of biology called cell biology examines the composition, operation, and behavior of…

Q: The kidney is a target of several complicated pathways, but the effects can be summarized as the…

A: Introduction The kidneys are bean-shaped organs and reddish-brown that are found in the…

Q: Which of the following is true about the innate immune system? Check all that apply Phagocytosis…

A: Immunity is defined as all of the physiological mechanisms that allow a person's body to recognise…

Q: 3. What is the importance of buffering in cells and tissues?

A: Buffers These are the chemicals that help a liquid to maintain a constant pH upon the addition of…

Q: What are the three phases of hepatitis viral infection?

A: Hepatitis caused by a viral infection damages and inflames the liver. Hepatitis is brought on by a…

Q: Is the population in Hardy Weinberg equilibrium? (show your work) In your answer, describe what this…

A: Introduction Evolution is a term that relates to change. It is a continuous process that allows the…

Q: C- Find the vital capacity for a person with a total lung capacity of 7 L and a residual volume of…

A: Vital capacity can be defined as volume  of air exhaled after maximal inhalation. While Total lung…

Q: Erythritol is a natural sugar abundant in fruits and fermentingfoods. Pathogenic bacterial strains…

A: Erythritol is a natural sugar abundant in fruits and fermenting foods. Pathogenic bacterial strains…

Q: Will specialist or generalist herbivores tend to evolve resistance to plant toxins? Why?

A: Plans produce secondary metabolites for their difference against herbivores. The chemicals including…

Q: Other than bacteria list the other 6 types of Microorganisms

A: Introduction The word microorganism is derived from two words "micro" meaning "small" (10-6) and…

Q: Trace the route of bile salts and acids from formation to recycling.

A: Bile salts are produced in the liver. These are made of bile acids that are conjugated with glycine…

Q: Bryophyte Seedless Vascular Plant Angiosperms [Choose ] Mid Largest Smallest [Choose ]

A: Introduction Gametophyte refers to the sexual stage of plants and some algae that involves the…

Q: __________ is a substance secreted by cells in the lungs that reduces surface tension.

A: Introduction :  Chemical substances known as surfactants are employed to reduce the surface tension…