You are an expert in DNA-repair mechanisms. You receive a sample of a human cell line derived from a woman who has symptoms of xeroderma pigmentosum. You determine that she has a mutation in a gene that has not been previously associated with XP. How is this possible?

You are an expert in DNA-repair mechanisms. You receive a sample of a human cell line derived from a woman who has symptoms of xeroderma pigmentosum. You determine that she has a mutation in a gene that has not been previously associated with XP. How is this possible?

Name: You are an expert in DNA-repair mechanisms. You receive a sample of a
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: You are an expert in DNA-repair mechanisms. You receive a sample of a human cell line derived from a woman who has symptoms of xeroderma pigmentosum. You determine that she has a mutation in a gene that has not been previously associated with XP. H

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 14QP

See similar textbooks

Similar questions

Why are X rays more potent mutagens than UV radiation?
Our bodies are not defenseless against mutagens that alter our genomic DNA sequences. What mechanisms are used to repair DNA?
Cloning Genes Is a Multistep Process In cloning human DNA, why is it necessary to insert the DNA into a vector such as a bacterial plasmid?
Contrast the various types of DNA repair mechanisms known to counteract the effects of UV radiation. What is the role of visible light in repairing UV-induced mutations?
Gene therapy is currently a fairly expensive treatment. For rare conditions, the fewer the people treated, the more expensive the treatment will be. But whatis the right price for a cure?
One type of cancer is caused by a mutation that occurs in a gene whose length is 2kb. A 200bp deletion is responsible for this mutation, and it is dominant, meaning you only need to have one copy of it to have cancer. A Southern Blot could diagnose this disease, but describe how you could diagnose this disease using PCR instead.
Describe the role of mismatch repair (MMR) in DNA repair. Why can mutations in MMR increase the risk of human cancer?
Researchers sometimes use gamma rays to induce deletion mutations in certain organisms and thus create mutant strains. What might this suggest regarding how exactly gamma rays interact with DNA? What are they probably causing to happen that results in these deletion mutations?
A biology professor at a prestigious university stated to his introductory class that "Today, a basic understanding of DNA and genetics is as important as a basic understanding of computers and the internet."Based upon what you have learned about DNA and gene expression in this module, how could you make a case to support this statement?
Which of the following statements about inherited DNA repair syndromes are correct (select all that apply)? A. There are no known genetic defects in Homologous Recombination Repair pathways in humnas B. Mutant BRCA 1 or 2 alleles are the most common genetic defect found in colon cancers C. Individuals with genetic defects in Nucleotide Excision Repair are more sensitive to UV light-induced cancers D. The increased skin cancer risk syndrome xeroderma pigmentosum is due to defects in Nucleotide Excision Repair enzymes E. Hereditary Non-Polyposis Colon Cancer is associated with defects in Mismatch Repair enzymes
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
An interesting trait that some bacteria exhibit is resistance to beingkilled by antibiotics. For example, certain strains of bacteria areresistant to tetracycline, whereas other strains are sensitive to tetracycline.Describe an experiment you would carry out to demonstratethat tetracycline resistance is an inherited trait encoded bythe DNA of the resistant strain.