mutations 2If a mutation occurs, it does not necessarily cause a genetic disease. Why?Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answerThe mutated.codon and the correct.codon both code for the same amino acid.The mutation does not occurin the reproductive cellsThe mutateed codon codes for a similar amino acid that does not affect the protein structure.Alrorereasonschat.amutacion may not cause o genetic disease.

The mutation is a sudden change in the DNA sequence in an organism that causes changes in nucleotide…

Answered: If a mutation occurs, it does not…

Science

Biology

If a mutation occurs, it does not necessarily cause a genetic disease. Why?

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 15SQ: Match the terms with the best description. __ genetic message a. protein-coding segment __ promoter...

See similar textbooks

Similar questions

1. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 4 5 6 7 (b) "In this mutation, the UGG codon is replaced with UGA." missense mutation nonsense mutation silent mutation frameshift mutation
A set of cells that host various DNA fragments collectively representing an organisms entire set of genetic information is a _________. a. genome b. clone c. genomic library d. GMO
Up to ______ amino adds can be encoded by an mRNA that consists of 45 nucleotides plus a stop codon. a. 15 b. 45 c. 90 d. 135
Match the terms with the best description. __ genetic message a. protein-coding segment __ promoter b. KN A polymerase binding site __ polysome c. read as base triplets __ exon d. removed before translation __ genetic code e. occurs only in groups __ intron f. complete set of 64 codons
Enhanced Spatial Learning in Mice With an Autism Mutation Autism is a neurobiological disorder with symptoms that include impaired social interactions and stereotyped patterns of behavior. Around 10 percent of autistic people have an extraordinary skill or talent such as greatly enhanced memory. Mutations in neuroligin 3, an adhesion protein that connects brain cells to one another, have been associated with autism. One mutation changes amino acid 451 from arginine to cysteine. In 2007, Katsuhiko Tabuchi and his colleagues genetically modified mice to carry the same arginine-to-cysteine substitution in their neuroligin 3. Mice with the mutation had impaired social behavior. To test spatial learning ability, the mice were placed in a water maze: a deep pool of warm water in which a platform is submerged a few millimeters below the surface. The platform is not visible to swimming mice. Mice do not particularly enjoy swimming, so they locate a hidden platform as fast as they can. When tested again, they can remember its location by checking visual cues around the edge of the pool. How quickly they remember the platforms location is a measure of spatial learning ability (FIGURE 15.18). FIGURE 15.18 spatial learning ability in mica mutation in neuroligin 3 (R451C), compared with unmodified (wild-type) mica. 2. Did the modified or the unmodified mice learn the location of the platform faster in the first test?
Enhanced Spatial Learning Ability in Mice Engineered to Carry an Autism Mutation Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory. Mutations in the gene for neuroligin 3, an adhesion protein that connects brain cells, have been associated with autism. One of these mutations is called R451C because the altered gene encodes a protein with an amino acid substitution: a cysteine (C) instead of an arginine (R) in position 451. In 2007, Katsuhiko Tabuchi and his colleagues introduced the R451C mutation into the neuroligin 3 gene of mice. The researchers discovered that the genetically modified mice had impaired social behavior and superior spatial learning ability. Spatial learning in mice is tested with a water maze, which consists of a small platform submerged a bit below the surface or a pool of water so it is invisible to a swimming mouse. Mice do not particularly enjoy swimming, so they try to locate the hidden platform as quickly as they can. When tested again later, they remember the platforms location by checking visual cues around the edge or the pool. How quickly they remember is a measure of their spatial learning ability. FIGURE 15.14 shows some or Tabuchis result. FIGURE 15.14 Spatial learning ability in mice. Mice with a mutation in neuroligin 3 (R451C) were tested for learning performance: as compared with unmodified (wild-type) mice. Did the modified or the unmodified mice learn the location of the platform faster in the first test?
CATCTACAAATAGCACCTAATTGTG What is the MRNA What is the protein What is the phenotype
1. (a)What mutation would result to a change of AUG codon to AGG? missense mutation nonsense mutation silent mutation frameshift mutation (b) Which mutation that would result to a change of amino acid in the polypeptide? missense mutation nonsense mutation silent mutation frameshift mutation
1. (a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." missense mutation nonsense mutation silent mutation frameshift mutation (b) How many codons are found in the mRNA below?mRNA 5 - AAUAUGCGGAUGCCCGAA -3 4 5 6 7
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
1. (a) Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 AAU UUA AUG UAG (b) There is an addition of Adenine in the mRNA sequence specifically at AUG codon. missense mutation nonsense mutation silent mutation frameshift mutation
Which of the following is NOT true about mutations? A. Mutations can be harmful but not beneficial to the cell B. Nucleotide substitution in DNA can cause nonsense mutations C. Nucleotide substitution in DNA can cause missense mutations D. Mutagens increase the rate of mutation, but mutations are still random E. Nucleotide insertion or deletion in DNA can cause frameshift mutations