You are characterizing a new DNA polymerase. In a test tube, you incubate the enzyme with all thecomponents needed for catalysis, EXCEPT you don't add any dNTPs. However, you notice thatsome type of catalysis has occurred. What is the most likely product in this case?O The supercoils in the DNA have been relievedO The sugar has been converted from a deoxyribose to a riboseA DNA strand is one base shorter due to nuclease activityThe magnesium ion has been converted to a charge of +2 to +1

DNA is a molecule made up of two strands twisted around each other in a double helix shape. Each…

Answered: You are characterizing a new DNA…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

The 3′ → 5′ exonuclease activity of Pol I excises only unpaired 3′-terminal nucleotides from DNA, whereas this enzyme’s pyrophosphorolysis activity removes only properly paired 3′-terminal nucleotides. Discuss the mechanistic signifi cance of this phenomenon in terms of the polymerase reaction.
Is it unusual that the -subunits of DNA polymerase III that form a sliding clamp along the DNA do not containthe active site for the polymerization reaction? Explain your answer.
Richard Boyce and Paul Howard-Flanders conducted an experimentthat provided biochemical evidence that thymine dimers areremoved from DNA by a DNA repair system. In their studies, bacterialDNA was radiolabeled so the amount of radioactivity reflectedthe amount of thymine dimers. The DNA was thensubjected to UV light, causing the formation of thymine dimers. When radioactivity was found in the soluble fraction, thymine dimershad been excised from the DNA by a DNA repair system.But when the radioactivity was in the insoluble fraction, the thyminedimers had been retained within the DNA. The following tableillustrates some of the experimental results involving a normalstrain of E. coli and a mutant strain that was very sensitive to killingby UV light: Explain the results found in this table. Why is the mutant strainsensitive to UV light?
Although DNA polymerases require both a template and a primer, the following single-stranded polynucleotide was found to serve as a substrate for DNA polymerase in the absence of any additional DNA.3′ HO-ATGGGCTCATAGCCGGAGCCCTAACCGTAGACCACGAATAGCATTAGG-p 5′What is the structure of the product of this reaction?
You desperately need to join two DNA fragments, one with an EcoRl site and the other with a BamHI site.Both enzymes leave 5' overhangs cutting after the first base. EcoR/ cuts at gaattc, BamHI at ggatcc. Whichof the following statements is true? A. You can not ligate these fragments.B. You can remove the overhangs with another restriction and ligate the blunted ends.C. You can fill in the ends with DNA polymerase and ligate the blunt ends.D. This can be done directly as the 5' overhangs anneal.E. You are better to replace EcoR/ with a related enzyme that leaves a ligatable 3' overhang. Please explain why it's C
Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is added to the growing DNA strand. Withregard to pyrimidines and purines, two general types of mistakes are possible. The addition of an incorrectpyrimidine instead of the correct pyrimidine (e. g. adding cytosine where thymine should be added) is called atransition. If a pyrimidine is incorrectly added to the growing strand instead of purine (e.g. adding cytosine when anadenine should be added), this type of mistake is called a transversion. If a transition or transversion is not detected by DNA polymerase, a mutation is created the permanently changes the DNA sequence. Though both types of mutations are rare, transition mutations are more frequent than transversion mutations. What are at least three explanations as to why this is the case?
If DNA polymerase requires a perfectly pairedprimer in order to add the next nucleotide, how is it thatany mismatched nucleotides “escape” this requirementand become substrates for mismatch repair enzymes?
Here are two strands of DNA. —————————————— DNA polymerase→ —————————————————————— The one on the bottom is a template strand, and the one on the top is being synthesized by DNA polymerase in the direction shown by the arrow. Label the 5′ and 3′ ends of the top and bottom strands.
In Noll’s experiment , explain where DNase I cuts the DNA. Why were the bands on the gel in multiples of 200 bp at lower DNase I concentrations?
Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’
Reiji and Tuneko Okazaki conducted a now classic experiment in1968 in which they discovered a population of short fragmentssynthesized during DNA replication. They introduced a shortpulse of 3H-thymidine into a culture of E. coli and extracted DNAfrom the cells at various intervals. In analyzing the DNA aftercentrifugation in denaturing gradients, they noticed that as theinterval between the time of 3H-thymidine introduction and thetime of centrifugation increased, the proportion of short strandsdecreased and more labeled DNA was found in larger strands.What would account for this observation?
Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is added to the growing DNA strand. With regard to pyrimidines and purines, two general types of mistakes are possible. The addition of an incorrect pyrimidine instead of the correct pyrimidine (e.g., adding cytosine where thymine should be added) is called a transition. If a pyrimidine is incorrectly added to the growing strand instead of purine (e.g., adding cytosine where an adenine should be added), this type of mistake is called a transversion. If a transition or transversion is not detected by DNA polymerase, a mutation is created that permanently changes the DNA sequence. Though both types of mutations are rare, transition mutations are more frequent than transversion mutations. Based on your understanding of DNA replication and DNA polymerase, offer three explanations why transition mutations are more common.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS