the DNA segment 5′-ATGAGGCATGAGACG-3′(coding strand) 3′-TACTCCGTACTCTGC-5′ (template strand) • What products would be formed from the segment’s replication? • Write the mRNA sequence that would be obtained from the segment’s transcription. • What is the amino acid sequence of the peptide produced from the

the DNA segment 5′-ATGAGGCATGAGACG-3′(coding strand) 3′-TACTCCGTACTCTGC-5′ (template strand) • What products would be formed from the segment’s replication? • Write the mRNA sequence that would be obtained from the segment’s transcription. • What is the amino acid sequence of the peptide produced from the

Name: In the DNA segment5′-ATGAGGCATGAGACG-3′(coding strand) 3′-TACTCCGTACTC
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: In the DNA segment5′-ATGAGGCATGAGACG-3′(coding strand) 3′-TACTCCGTACTCTGC-5′ (template strand)• What products would be formed from the segment’s replication?• Write the mRNA sequence that would be obtained from the segment’s transcription.• What is t

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 21CTQ: A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is...

See similar textbooks

Similar questions

Transcribe and Translate the origininal DNA sequence, then in mutated dna sequence identify the Mrna sequence and type of its mutationGENERAL DNA SEQUENCE 3' TAC CGC TTA CGT CTG ATC GCT 5'-------------------------------------------------------------------------MUTATED DNA SEQUENCE1. 3' TAC ATC CGC TTA CGT CTG ATC GCT 5'2. 3' TAC GCG CTT ACG TCT GAT CGC T 5'3. 3' TAC CGC TTA TTA TTA CGT GCT GCT ATC GCT 5'4. 3' TAC CGC TAA TTA TTA CGT GCT GCT ATC GCT 5'Amino acid of each mutated sequence _______________type of mutation of each mutated sequence _______________
Transcribe and Translate the origininal DNA sequence, then in mutated dna sequence identify the Mrna sequence and type of its mutationGENERAL DNA SEQUENCE 3' TAC CGC TTA CGT CTG ATC GCT 5'-------------------------------------------------------------------------MUTATED DNA SEQUENCE1. 3' TAC CGC TTA TTA TTA CGT GCT GCT ATC GCT 5'2. 3' TAC CGC TAA TTA TTA CGT GCT GCT ATC GCT 5'Amino acid of each mutated sequence _______________type of mutation of each mutated sequence _______________
DNA: CATCTACAAATAGCACCTAATTGTG What would be the MRNA:? Protein? Phenotype?
Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'
For each DNA segment: [1] What is the sequence of the mRNA molecule synthesized from each DNA template? [2] What is the sequence of the informational strand of the DNA molecule? a. 3 '–TGCCTAACG–5 ' c. 3 '–TTAACGCGA–5 'b. 3 '–GACTCC–5 ' d. 3 '–CAGTGACCGTAC–5 '
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
Examine the following sequence of DNA3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG – ACT – AGG-5’Write out the complementary DNA sequence (identify 3’ and 5’ ends)Write out the complementary mRNA sequenceWrite out the peptide sequence this DNA encodes
A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?
Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of each
C. Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
Transcribe the DNA sequence that follows. What type of molecule did you make? How many codons are there in this sequence? TACCCAACAATT
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.