6 4. You are investigating the DNA-binding interaction of the drug candidate below, which binds to DNA viaintercalation('(H3C)2NYou are lazy and don't want to do real computational simulations. You just estimate AHbinding based on thebinding motif, shown below (drug is flat molecule in middle sandwiched between adjacent DNA basepairs). What would you estimate? Explain how you arrived at this number. (an aromatic interaction -5kJ/mol)N(CH3)2а.b. OK, your boss convinces to do real energy calculations from computer simulations for a DNA segment.Values of energies and entropies (calc'd at 298 K) are given below. Calculate the drug-DNA bindingJconstant. R=8.314mol · KE (kJ/mol)-5984563MoleculeS (J/mol*K)DrugDNA segmentDrug-DNA complex-104752534255-98767883499677c. If you have a 10-base-pair segment of DNA, with 8 potential drug-binding sites, would you expect thedifferent binding sites to be cooperative, anti-cooperative, or non-cooperative? Explain.d. Is the DNA-drug binding enthalpically or entropically favored?

The study of interaction between drug and protein is very important to understand its mechanism of…

Answered: You are investigating the DNA-binding…

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

5) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differences between the reaction catalyzed by the polymerase activity of a DNA polymerase and the reaction catalyzed by ligase.
1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
The two complementary strands of the DNA double helix are held to each other by (a) ionic bonds between deoxyribose molecules (b) ionic bonds between phosphate groups (c) covalent bonds between nucleotide bases (d) covalent bonds between deoxyribose molecules (e) hydrogen bonds between nucleotide bases
1. discuss the effect of temperature on the viscosity of the liquid 2. DNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?
3,Compare the free energy, ∆G, of A-T binding and A-C binding, which one is more negative? Does this makes sense in terms of the structure of DNA? Group of answer choices A, ∆G of the A-T binding is more negative than that of the A-C binding, which is consistent with the fact that A-C binding is not favored in DNA helix. B, ∆G of the A-T binding is more negative than that of the A-C binding, which is consistent with the fact that A-C binding is favored in DNA helix. C, ∆G of the A-C binding is more negative than that of the A-T binding, which is consistent with the fact that A-C binding is not favored in DNA helix. D, ∆G of the A-C binding is more negative than that of the A-T binding, which is consistent with the fact that A-C binding is favored over A-T binding in DNA helix.
1. what are the three main steps of a solid phase DNA extraction? Answer is Lysis, but does not include precipitation and purification 2. ) Most STR fragments used in human forensic analysis are composed of _____ repeats.
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
5. Which of the following alternative steps cannot be employed in the DNA extraction because it would cause denaturation of some DNA? a. Using vodka instead of isopropyl alcohol. b. Using warm isopropyl alcohol instead of cold isopropyl alcohol. c. Using ammonium chloride for the soapy salt solution instead of sodium chloride. d. Using unscented and uncolored liquid soap for the soapy salt solution 6. Which property of DNA makes it possible to wrap it around the toothpick? a. DNA has a double-stranded helical structure b. DNA is color white. c. DNA is made up of long and thin strands. d. DNA carries genetic information
2) The authors investigate if the switch from the polymerase to the exonuclease site involves releasing and re-binding of the DNA or if it utilizes an intramolecular rearrangement. To accomplish this, they use a primer-extension assay. How is a primer extension assay performed? In answering this question, be sure to mention a.) why heparin is used, b.) how they generate mismatched primers, and c.) how they visualize only the primer strand and not the template strand on their gel.
5. The DNA sample in your final vial contains numerous strands of DNA ( 46 chromosomes from EACH cell lysed; and we hope hundreds of cells were lysed). Despite having all of this DNA present in your vial with the Master Mix, only one specific portion of your DNA will be amplified ; which part? How are we able to locate and copy just this region instead of accidentally copying other regions of DNA ?
1. UV light damages DNA by the formation of pyrimidine dimers. Draw the detailed chemical structure of a pyrimidine dimer and explain why the formation of such aberrant structures results in tumor-enabling genomic instability. 2. Use your own words to define ultraviolet light. Include a comparison of naturally-occurring vs artificial UV. What is UV-A? UV-B? UV-C? Which one(s) is (are) the most damaging to DNA? Why? Which one(s) are most likely to lead to a mutation in skin cells? Why? What type of UV light is used in tanning beds?
1. Which of the following actions in the DNA extraction of strawberry separates the DNA from the rest of the solution? a. Addition of cold isopropyl alcohol b. crushing the strawberry c. Addition of soapy salt solution d. Filtration of the crushed strawberries 2. What does the salt in the soapy salt solution do in the DNA extraction? a. It dissolves the DNA. b. It displaced a lot of proteins to free the DNA. c. It disrupts the phospholipid bilayer. d. It precipitates the DNA.

SEE MORE QUESTIONS

Recommended textbooks for you

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS